Transcript: Mouse XM_017320012.1

PREDICTED: Mus musculus ubiquitin specific peptidase 48 (Usp48), transcript variant X14, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Usp48 (170707)
Length:
4488
CDS:
518..2101

Additional Resources:

NCBI RefSeq record:
XM_017320012.1
NBCI Gene record:
Usp48 (170707)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320012.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086674 CCGAGTTGAATGTGAGTAGTT pLKO.1 1635 CDS 100% 4.950 6.930 N Usp48 n/a
2 TRCN0000086676 CCCAGCGAATGGCAAATGATT pLKO.1 1394 CDS 100% 5.625 3.938 N Usp48 n/a
3 TRCN0000086673 GCTGTCAACAATTTGCTGAAA pLKO.1 668 CDS 100% 4.950 2.970 N Usp48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320012.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12793 pDONR223 100% 41.2% 45.7% None (many diffs) n/a
2 ccsbBroad304_12793 pLX_304 0% 41.2% 45.7% V5 (many diffs) n/a
3 TRCN0000473772 TTGATGTTGGAGTCAAATGCATTT pLX_317 65.7% 41.2% 45.7% V5 (many diffs) n/a
Download CSV