Transcript: Mouse XM_017320148.1

PREDICTED: Mus musculus CDC42 binding protein kinase alpha (Cdc42bpa), transcript variant X29, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdc42bpa (226751)
Length:
9880
CDS:
3056..7735

Additional Resources:

NCBI RefSeq record:
XM_017320148.1
NBCI Gene record:
Cdc42bpa (226751)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360802 AGCCCGACAGATACGTCAAAT pLKO_005 3392 CDS 100% 13.200 18.480 N Cdc42bpa n/a
2 TRCN0000022679 GCCCGACAGATACGTCAAATT pLKO.1 3393 CDS 100% 13.200 18.480 N Cdc42bpa n/a
3 TRCN0000022680 GCCGCTGCAATCATAGATCAT pLKO.1 6044 CDS 100% 4.950 6.930 N Cdc42bpa n/a
4 TRCN0000360798 CCGAGAGCAGAGCGAACATTA pLKO_005 4246 CDS 100% 13.200 10.560 N Cdc42bpa n/a
5 TRCN0000360799 AGTAAACCCTCACGAATTAAA pLKO_005 7993 3UTR 100% 15.000 10.500 N Cdc42bpa n/a
6 TRCN0000195596 CCAGGCTAGTGAGCGATTAAA pLKO.1 3958 CDS 100% 15.000 10.500 N CDC42BPA n/a
7 TRCN0000022682 GCACCTTACATCCCAGAAGTT pLKO.1 3368 CDS 100% 4.950 3.465 N Cdc42bpa n/a
8 TRCN0000022681 GCATCTAACATCTTAACAGAA pLKO.1 5015 CDS 100% 4.950 3.465 N Cdc42bpa n/a
9 TRCN0000022683 GCACAGGAAGTTTAAGGAGAT pLKO.1 6397 CDS 100% 4.050 2.835 N Cdc42bpa n/a
10 TRCN0000199935 GCTCGCCATGTCCGAGATAAG pLKO.1 4091 CDS 100% 3.600 2.520 N CDC42BPA n/a
11 TRCN0000196514 GTGGAATTGATTGGGATAATA pLKO.1 3333 CDS 100% 15.000 10.500 N CDC42BPA n/a
12 TRCN0000096439 GCAGCAGGAAAGAGAAGAATT pLKO.1 3922 CDS 100% 0.000 0.000 Y Hivep3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.