Transcript: Mouse XM_017320296.1

PREDICTED: Mus musculus nuclear cap binding protein subunit 1 (Ncbp1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ncbp1 (433702)
Length:
2728
CDS:
280..2331

Additional Resources:

NCBI RefSeq record:
XM_017320296.1
NBCI Gene record:
Ncbp1 (433702)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320296.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254397 ACGGATGGGACCAGTATATTG pLKO_005 2146 CDS 100% 13.200 18.480 N Ncbp1 n/a
2 TRCN0000059506 GCACTCTACAATTCGTAAGAT pLKO.1 1881 CDS 100% 5.625 7.875 N NCBP1 n/a
3 TRCN0000254400 CACAACTTTCCTGTGATAAAT pLKO_005 2542 3UTR 100% 15.000 10.500 N Ncbp1 n/a
4 TRCN0000254399 GTCTTACCATCAACATATATT pLKO_005 1335 CDS 100% 15.000 10.500 N Ncbp1 n/a
5 TRCN0000246121 ACTACAAGAGCAAGATCTTAA pLKO_005 117 5UTR 100% 13.200 9.240 N NCBP1 n/a
6 TRCN0000254398 AGCTATGATTCGTCAACTTAA pLKO_005 276 5UTR 100% 13.200 9.240 N Ncbp1 n/a
7 TRCN0000265507 TTACCTGAGAAGCTAACAATT pLKO_005 193 5UTR 100% 13.200 9.240 N Ncbp1 n/a
8 TRCN0000059504 CCCTTGAACTACCACATAGTT pLKO.1 994 CDS 100% 0.563 0.394 N NCBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320296.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14708 pDONR223 60.4% 76.9% 84.5% None (many diffs) n/a
2 ccsbBroad304_14708 pLX_304 0% 76.9% 84.5% V5 (many diffs) n/a
Download CSV