Transcript: Mouse XM_017320459.1

PREDICTED: Mus musculus pumilio RNA-binding family member 1 (Pum1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pum1 (80912)
Length:
5368
CDS:
165..3728

Additional Resources:

NCBI RefSeq record:
XM_017320459.1
NBCI Gene record:
Pum1 (80912)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320459.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146945 CCAGCTTGTCTTCAATGAAAT pLKO.1 2801 CDS 100% 13.200 18.480 N PUM1 n/a
2 TRCN0000285399 CCAGCTTGTCTTCAATGAAAT pLKO_005 2801 CDS 100% 13.200 18.480 N PUM1 n/a
3 TRCN0000102252 CGCTCTATGGATGAATTGAAT pLKO.1 531 CDS 100% 5.625 7.875 N Pum1 n/a
4 TRCN0000287316 CGCTCTATGGATGAATTGAAT pLKO_005 531 CDS 100% 5.625 7.875 N Pum1 n/a
5 TRCN0000102254 CCAACTTATGGTGGATGTGTT pLKO.1 2837 CDS 100% 4.950 3.960 N Pum1 n/a
6 TRCN0000287315 CCAACTTATGGTGGATGTGTT pLKO_005 2837 CDS 100% 4.950 3.960 N Pum1 n/a
7 TRCN0000148263 GTGACCTTTATAAGAGGACAT pLKO.1 2308 CDS 100% 4.050 3.240 N PUM1 n/a
8 TRCN0000294814 TGATCTCAAACTGGCATTTAA pLKO_005 4209 3UTR 100% 15.000 10.500 N Pum1 n/a
9 TRCN0000102251 GCTGGGCATATAATGGAATTT pLKO.1 2715 CDS 100% 13.200 9.240 N Pum1 n/a
10 TRCN0000287314 GCTGGGCATATAATGGAATTT pLKO_005 2715 CDS 100% 13.200 9.240 N Pum1 n/a
11 TRCN0000102250 CCCTGCTGTTTACTGGTGTAT pLKO.1 3948 3UTR 100% 4.950 3.465 N Pum1 n/a
12 TRCN0000102253 CCTGCTGCTTACTATGACCAA pLKO.1 1830 CDS 100% 2.640 1.848 N Pum1 n/a
13 TRCN0000287246 CCTGCTGCTTACTATGACCAA pLKO_005 1830 CDS 100% 2.640 1.848 N Pum1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320459.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07469 pDONR223 100% 93.8% 98.9% None (many diffs) n/a
2 ccsbBroad304_07469 pLX_304 0% 93.8% 98.9% V5 (many diffs) n/a
Download CSV