Transcript: Mouse XM_017320591.1

PREDICTED: Mus musculus ring finger protein 216 (Rnf216), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf216 (108086)
Length:
4790
CDS:
302..3034

Additional Resources:

NCBI RefSeq record:
XM_017320591.1
NBCI Gene record:
Rnf216 (108086)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320591.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010789 ACACTATGCAATCACCCGAAA pLKO.1 1633 CDS 100% 4.050 5.670 N RNF216 n/a
2 TRCN0000272691 ACACTATGCAATCACCCGAAA pLKO_005 1633 CDS 100% 4.050 5.670 N RNF216 n/a
3 TRCN0000003466 GACACTATGCAATCACCCGAA pLKO.1 1632 CDS 100% 2.160 3.024 N RNF216 n/a
4 TRCN0000040569 GCGACATTCTGAATCAGAAAT pLKO.1 1027 CDS 100% 13.200 10.560 N Rnf216 n/a
5 TRCN0000040570 CGTGCGTGTCAACTATGACTT pLKO.1 2941 CDS 100% 4.950 3.960 N Rnf216 n/a
6 TRCN0000040571 GCTACCTCTGTCGAGTTTCTA pLKO.1 2535 CDS 100% 5.625 3.938 N Rnf216 n/a
7 TRCN0000040568 GCTCACTTGTTCTGCAAAGAA pLKO.1 2033 CDS 100% 5.625 3.938 N Rnf216 n/a
8 TRCN0000040572 CCAGAAAGTGAGCCTTTGGAA pLKO.1 833 CDS 100% 3.000 1.800 N Rnf216 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320591.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10647 pDONR223 100% 5.1% 4% None (many diffs) n/a
2 ccsbBroad304_10647 pLX_304 0% 5.1% 4% V5 (many diffs) n/a
3 TRCN0000475787 AGGGTTGCTCTCTGCCTCCACAGC pLX_317 100% 5.1% 4% V5 (many diffs) n/a
Download CSV