Transcript: Mouse XM_017320706.1

PREDICTED: Mus musculus cadherin 7, type 2 (Cdh7), transcript variant X13, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdh7 (241201)
Length:
3111
CDS:
1150..3096

Additional Resources:

NCBI RefSeq record:
XM_017320706.1
NBCI Gene record:
Cdh7 (241201)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320706.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094785 GCCATTACTATACTGGATATT pLKO.1 2554 CDS 100% 13.200 18.480 N Cdh7 n/a
2 TRCN0000448164 AGAGGCTAAAGACCAGTATTT pLKO_005 1809 CDS 100% 13.200 9.240 N CDH7 n/a
3 TRCN0000094787 GCTTAACAACAGACATGACAA pLKO.1 2708 CDS 100% 4.950 3.465 N Cdh7 n/a
4 TRCN0000094788 GCAAAGGATATGGTTGGTCAA pLKO.1 1843 CDS 100% 4.050 2.835 N Cdh7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320706.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10725 pDONR223 100% 86.1% 94.4% None (many diffs) n/a
2 ccsbBroad304_10725 pLX_304 0% 86.1% 94.4% V5 (many diffs) n/a
3 TRCN0000479284 AATCGACTTTAACAATCCCGACCT pLX_317 22.7% 86.1% 94.4% V5 (many diffs) n/a
Download CSV