Transcript: Mouse XM_017321375.1

PREDICTED: Mus musculus cell adhesion molecule L1-like (Chl1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chl1 (12661)
Length:
7552
CDS:
220..3849

Additional Resources:

NCBI RefSeq record:
XM_017321375.1
NBCI Gene record:
Chl1 (12661)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321375.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094912 CGGCTAACAATTCAGGCACAT pLKO.1 473 CDS 100% 4.050 5.670 N Chl1 n/a
2 TRCN0000094910 GCCAAATCATACTGGTGTATA pLKO.1 1395 CDS 100% 13.200 10.560 N Chl1 n/a
3 TRCN0000094913 CCTGCCCAAATGGGAAGTTTA pLKO.1 940 CDS 100% 13.200 9.240 N Chl1 n/a
4 TRCN0000094911 GCTGACAGTTTAGTGGAATAT pLKO.1 3703 CDS 100% 13.200 9.240 N Chl1 n/a
5 TRCN0000094909 CCCATTTCAGATACTCCACAT pLKO.1 4117 3UTR 100% 4.050 2.835 N Chl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321375.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11544 pDONR223 100% 84.6% 84.7% None (many diffs) n/a
2 ccsbBroad304_11544 pLX_304 0% 84.6% 84.7% V5 (many diffs) n/a
3 TRCN0000479321 TGAAATTTGTTCCCACTCAGCATT pLX_317 13.6% 84.6% 84.7% V5 (many diffs) n/a
Download CSV