Transcript: Mouse XM_017321392.1

PREDICTED: Mus musculus G protein-coupled receptor 19 (Gpr19), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gpr19 (14760)
Length:
2754
CDS:
1170..2636

Additional Resources:

NCBI RefSeq record:
XM_017321392.1
NBCI Gene record:
Gpr19 (14760)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321392.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328128 CTATGTGGGCATTTCGGAAAT pLKO_005 2498 CDS 100% 10.800 15.120 N Gpr19 n/a
2 TRCN0000328129 GCAGTCACGTGGGTATCTTTC pLKO_005 2328 CDS 100% 10.800 15.120 N Gpr19 n/a
3 TRCN0000028165 CCGCTTCTATACCATCGTCTA pLKO.1 1874 CDS 100% 4.050 5.670 N Gpr19 n/a
4 TRCN0000028162 CGCTTTGTGGTTGTTCTCCAT pLKO.1 1607 CDS 100% 2.640 3.696 N Gpr19 n/a
5 TRCN0000328126 CCACTCTGTACTCTATTTATA pLKO_005 2368 CDS 100% 15.000 10.500 N Gpr19 n/a
6 TRCN0000328127 TCTGCATGTCCTCGATGAAAT pLKO_005 2422 CDS 100% 13.200 9.240 N Gpr19 n/a
7 TRCN0000328193 TCTTGGTGGGCTTCGTGATTC pLKO_005 2071 CDS 100% 10.800 7.560 N Gpr19 n/a
8 TRCN0000028189 CCTGCTCTTGAACCTAGTGTT pLKO.1 2222 CDS 100% 4.950 3.465 N Gpr19 n/a
9 TRCN0000028174 CGTGGGTATCTTTCAGCTCTT pLKO.1 2335 CDS 100% 4.050 2.835 N Gpr19 n/a
10 TRCN0000028198 CCCACTCTGTACTCTATTTAT pLKO.1 2367 CDS 100% 15.000 9.000 N Gpr19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321392.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487695 GAATTTATTGACATATCTATAATT pLX_317 21.8% 70.1% 75.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000487692 AAAGTACCAAGCGGCCGTTTACCG pLX_317 21.8% 70% 75.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000488209 ACGTATTACATCCCTGAGGGAATT pLX_317 29.4% 69.9% 75.1% V5 (many diffs) n/a
Download CSV