Transcript: Mouse XM_017321412.1

PREDICTED: Mus musculus MyoD family inhibitor domain containing (Mdfic), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mdfic (16543)
Length:
2126
CDS:
495..1073

Additional Resources:

NCBI RefSeq record:
XM_017321412.1
NBCI Gene record:
Mdfic (16543)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321412.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362431 GCCGGATGTATGTGGTTTAAT pLKO_005 1234 3UTR 100% 15.000 21.000 N Mdfic n/a
2 TRCN0000095980 CCGTGGAGAATCACAAGATAT pLKO.1 682 CDS 100% 13.200 18.480 N Mdfic n/a
3 TRCN0000362509 GTTTATCTATTGGAGGTTAAA pLKO_005 1455 3UTR 100% 13.200 10.560 N Mdfic n/a
4 TRCN0000095981 CGAAGCATGTAATGAGGACAA pLKO.1 422 5UTR 100% 4.050 3.240 N Mdfic n/a
5 TRCN0000237995 ATCGTCAGACTGTCTAGAAAT pLKO_005 1016 CDS 100% 13.200 9.240 N Mdfic n/a
6 TRCN0000095979 CGCCGGATGTATGTGGTTTAA pLKO.1 1233 3UTR 100% 13.200 9.240 N Mdfic n/a
7 TRCN0000095982 GACATCAGTAAGAAGAGTAAA pLKO.1 762 CDS 100% 13.200 9.240 N Mdfic n/a
8 TRCN0000237997 GGAGGAAACAGGCAAGATAAA pLKO_005 599 CDS 100% 13.200 9.240 N Mdfic n/a
9 TRCN0000362432 TCCTGACCCTCTGCAACATTG pLKO_005 868 CDS 100% 10.800 7.560 N Mdfic n/a
10 TRCN0000237994 TGATGCGGGACCAGTCCATTT pLKO_005 493 5UTR 100% 10.800 7.560 N Mdfic n/a
11 TRCN0000237996 TGACATGGACTGCGGCATCAT pLKO_005 980 CDS 100% 4.950 3.465 N Mdfic n/a
12 TRCN0000095983 TGCAACATTGTCCTGGGACAA pLKO.1 879 CDS 100% 0.405 0.284 N Mdfic n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321412.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.