Transcript: Mouse XM_017321523.1

PREDICTED: Mus musculus cAMP responsive element binding protein 5 (Creb5), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Creb5 (231991)
Length:
5365
CDS:
175..1602

Additional Resources:

NCBI RefSeq record:
XM_017321523.1
NBCI Gene record:
Creb5 (231991)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321523.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000454919 GTTGGTGCTTCTCTGCAATTT pLKO_005 1825 3UTR 100% 13.200 18.480 N Creb5 n/a
2 TRCN0000082309 GCAGTTGTTGTTAACACATAA pLKO.1 1371 CDS 100% 13.200 9.240 N Creb5 n/a
3 TRCN0000454939 GAACAGACCTGAATCCTATTC pLKO_005 1577 CDS 100% 10.800 7.560 N Creb5 n/a
4 TRCN0000082308 CCCAAATAATTCACCTCCTAA pLKO.1 3117 3UTR 100% 4.950 3.465 N Creb5 n/a
5 TRCN0000085680 CCCTTCAATAAAGACAGACAA pLKO.1 213 CDS 100% 4.950 3.465 N n/a
6 TRCN0000013484 CCTTCAATAAAGACAGACAAT pLKO.1 214 CDS 100% 4.950 3.465 N CREB5 n/a
7 TRCN0000085681 GCACGAGATGACTTTGAAGTT pLKO.1 192 CDS 100% 4.950 3.465 N n/a
8 TRCN0000085679 GCCCACAAGATTCCTGAAGAA pLKO.1 258 CDS 100% 4.950 3.465 N n/a
9 TRCN0000082311 CAGAAAGAATCCCAAGGGTAT pLKO.1 1414 CDS 100% 4.050 2.835 N Creb5 n/a
10 TRCN0000082312 GCTTCAGAATGAAGTGTCCAT pLKO.1 1323 CDS 100% 2.640 1.848 N Creb5 n/a
11 TRCN0000082310 GCCAGGATCTTCTGCCGTCTT pLKO.1 639 CDS 100% 1.350 0.945 N Creb5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321523.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11393 pDONR223 100% 64% 69.4% None (many diffs) n/a
2 ccsbBroad304_11393 pLX_304 0% 64% 69.4% V5 (many diffs) n/a
3 TRCN0000469202 ATTCAGAAACACATTAAATCAATT pLX_317 48% 64% 69.4% V5 (many diffs) n/a
Download CSV