Construct: ORF TRCN0000469202
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003639.1_s317c1
- Derived from:
- ccsbBroadEn_11393
- DNA Barcode:
- ATTCAGAAACACATTAAATCAATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CREB5 (9586)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469202
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 9586 | CREB5 | cAMP responsive element bin... | NM_001011666.3 | 90.5% | 90.5% | 1_105del |
2 | human | 9586 | CREB5 | cAMP responsive element bin... | XM_017012810.1 | 76% | 75.8% | 1_105del;947A>G;948_949ins159 |
3 | human | 9586 | CREB5 | cAMP responsive element bin... | NM_182899.4 | 70.3% | 70.3% | 1_423del |
4 | human | 9586 | CREB5 | cAMP responsive element bin... | XM_024447005.1 | 70.3% | 70.3% | 1_423del |
5 | human | 9586 | CREB5 | cAMP responsive element bin... | NM_004904.3 | 66.6% | 66.6% | 1_501del |
6 | human | 9586 | CREB5 | cAMP responsive element bin... | XM_005249906.1 | 66.6% | 66.6% | 1_501del |
7 | human | 9586 | CREB5 | cAMP responsive element bin... | XM_017012806.1 | 66.6% | 66.6% | 1_501del |
8 | human | 9586 | CREB5 | cAMP responsive element bin... | NM_182898.4 | 65.7% | 65.7% | 1_522del |
9 | human | 9586 | CREB5 | cAMP responsive element bin... | XM_017012808.1 | 65.7% | 65.7% | 1_522del |
10 | human | 9586 | CREB5 | cAMP responsive element bin... | XM_017012807.1 | 62.1% | 62.1% | 1_609del |
11 | human | 9586 | CREB5 | cAMP responsive element bin... | XM_017012809.1 | 56% | 55.8% | 1_501del;1343A>G;1344_1345ins159 |
12 | human | 9586 | CREB5 | cAMP responsive element bin... | XR_001744893.2 | 12.6% | 1_294del;1297_7914del | |
13 | mouse | 231991 | Creb5 | cAMP responsive element bin... | NM_172728.2 | 85.1% | 92.4% | (many diffs) |
14 | mouse | 231991 | Creb5 | cAMP responsive element bin... | XM_011241296.1 | 75.2% | 81.1% | (many diffs) |
15 | mouse | 231991 | Creb5 | cAMP responsive element bin... | XM_017321523.1 | 64% | 69.4% | (many diffs) |
16 | mouse | 231991 | Creb5 | cAMP responsive element bin... | NM_001327821.1 | 60.6% | 65.8% | (many diffs) |
17 | mouse | 231991 | Creb5 | cAMP responsive element bin... | XM_017321522.1 | 60.6% | 65.8% | (many diffs) |
18 | mouse | 231991 | Creb5 | cAMP responsive element bin... | XM_017321521.1 | 59.8% | 64.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1068
- ORF length:
- 1002
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc agcctccatg cctgggaccc tgcccaaccc tacaatgcca ggatcttccg 121 ccgtcttgat gccaatggag cgacaaatgt cagtgaactc cagcatcatg gggatgcaag 181 gtccaaatct cagcaacccc tgtgcttctc cccaggtcca gccaatgcat tcagaagcca 241 aaatgaggtt gaaggctgca ttgactcacc accctgctgc catgtcaaat gggaacatga 301 acaccatggg acacatgatg gagatgatgg gctcccggca ggaccagacg ccacaccatc 361 acatgcactc gcacccgcat cagcaccaga cactgccacc ccatcaccct tacccacacc 421 agcaccagca cccagcacac catcctcacc ctcaacccca tcaccagcag aaccatccac 481 atcaccactc ccattcccac cttcatgcac acccagcaca tcaccagacc tcgccacatc 541 cgcccctgca caccggcaac caagcacagg tttcaccagc aacacaaCAG ATGCAGCCAA 601 CCCAGACAAT ACAGCCACCC CAGCCCACAG GGGGGCGCCG GCGAAGGGTG GTAGACGAGG 661 ATCCGGACGA GAGGCGGCGG AAATTTCTGG AACGGAACCG GGCAGCTGCC ACCCGCTGCA 721 GACAGAAGAG GAAGGTCTGG GTGATGTCAT TGGAAAAGAA AGCAGAAGAA CTCACCCAGA 781 CAAACATGCA GCTTCAGAAT GAAGTGTCTA TGTTGAAAAA TGAGGTGGCC CAGCTGAAAC 841 AGTTGTTGTT AACACATAAA GACTGCCCAA TAACAGCCAT GCAGAAAGAA TCACAAGGAT 901 ATCTAAGTCC AGAGAGTAGC CCTCCTGCTA GTCCTGTCCC AGCTTGCTCC CAGCAACAAG 961 TCATCCAGCA TAATACCATC ACTACTTCCT CATCGGTCAG CGAGGTGGTA GGAAGCTCCA 1021 CCCTCAGCCA GCTCACCACT CACAGAACAG ACCTGAATCC GATTCTTTAC CCAACTTTCT 1081 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1141 CGTAGTAATG AACTAGCCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1201 GTGGAAAGGA CGAATTCAGA AACACATTAA ATCAATTACG CGTTAAGTCg acaatcaacc 1261 tctggattac aaaatttgtg aaagatt