Transcript: Mouse XM_017321606.1

PREDICTED: Mus musculus muskelin 1, intracellular mediator containing kelch motifs (Mkln1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mkln1 (27418)
Length:
5895
CDS:
530..1747

Additional Resources:

NCBI RefSeq record:
XM_017321606.1
NBCI Gene record:
Mkln1 (27418)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321606.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091688 GCATACAATTTACAGGCATTT pLKO.1 2733 3UTR 100% 10.800 15.120 N Mkln1 n/a
2 TRCN0000091692 GCCCATCAACTCGTTTATGAT pLKO.1 1295 CDS 100% 5.625 4.500 N Mkln1 n/a
3 TRCN0000424605 GACTTGGTGCTGTAGGAATTT pLKO_005 2089 3UTR 100% 13.200 9.240 N Mkln1 n/a
4 TRCN0000091691 GCATGACAAATTGGTGTTAAA pLKO.1 288 5UTR 100% 13.200 9.240 N Mkln1 n/a
5 TRCN0000428374 TAGCCTTTAAGAATTAGTAAG pLKO_005 1989 3UTR 100% 10.800 7.560 N Mkln1 n/a
6 TRCN0000091689 GCGGAGACAAATCTACACATT pLKO.1 547 CDS 100% 4.950 3.465 N Mkln1 n/a
7 TRCN0000091690 GCCCAGCTTTAACTTTAGCAT pLKO.1 72 5UTR 100% 3.000 2.100 N Mkln1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321606.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06584 pDONR223 100% 51.2% 54.5% None (many diffs) n/a
2 ccsbBroad304_06584 pLX_304 0% 51.2% 54.5% V5 (many diffs) n/a
Download CSV