Transcript: Mouse XM_017321638.1

PREDICTED: Mus musculus family with sequence similarity 19, member A1 (Fam19a1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam19a1 (320265)
Length:
4860
CDS:
1963..2436

Additional Resources:

NCBI RefSeq record:
XM_017321638.1
NBCI Gene record:
Fam19a1 (320265)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321638.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000189890 CGGTCACAAACAGTGAAGTGT pLKO.1 2215 CDS 100% 3.000 4.200 N Fam19a1 n/a
2 TRCN0000202325 GTGGATAAGTGCTTGTGCGAT pLKO.1 2001 CDS 100% 2.640 3.696 N Fam19a1 n/a
3 TRCN0000201322 GTGTTGTAACAAGAACCGCAT pLKO.1 2187 CDS 100% 2.160 3.024 N Fam19a1 n/a
4 TRCN0000202313 GATGTGTGCTACAGGCAACAA pLKO.1 2382 CDS 100% 4.950 3.465 N Fam19a1 n/a
5 TRCN0000189671 CAACAAGAAACCGACCTTCCT pLKO.1 2264 CDS 100% 2.640 1.848 N Fam19a1 n/a
6 TRCN0000172421 CACTCCCTGACAATTCTGGAT pLKO.1 2360 CDS 100% 2.640 1.848 N TAFA1 n/a
7 TRCN0000168747 GAAGAATGTAAGACACTCCCT pLKO.1 2347 CDS 100% 0.660 0.462 N TAFA1 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3742 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321638.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05659 pDONR223 100% 77% 84% None (many diffs) n/a
2 ccsbBroad304_05659 pLX_304 0% 77% 84% V5 (many diffs) n/a
3 TRCN0000477047 TTTTCGCTTCACATCCCCTAGCAG pLX_317 91.1% 77% 84% V5 (many diffs) n/a
Download CSV