Transcript: Mouse XM_017322219.1

PREDICTED: Mus musculus armadillo repeat containing 5 (Armc5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Armc5 (233912)
Length:
3158
CDS:
669..2660

Additional Resources:

NCBI RefSeq record:
XM_017322219.1
NBCI Gene record:
Armc5 (233912)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322219.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257771 TGCGAGCTGTGTGCCTCTTAT pLKO_005 1702 CDS 100% 13.200 9.240 N Armc5 n/a
2 TRCN0000247757 TCTCACCCTAAACGGGCAATA pLKO_005 1527 CDS 100% 10.800 7.560 N Armc5 n/a
3 TRCN0000247754 TGTAGGCTTCCTTTATGATAC pLKO_005 1838 CDS 100% 10.800 7.560 N Armc5 n/a
4 TRCN0000156262 CCCTTTGGTGACCATTCTTCA pLKO.1 1124 CDS 100% 4.950 3.465 N ARMC5 n/a
5 TRCN0000156643 GAAGACAGACAGCATCCAGAA pLKO.1 1151 CDS 100% 4.050 2.430 N ARMC5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322219.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12618 pDONR223 100% 44.7% 46.9% None (many diffs) n/a
2 ccsbBroad304_12618 pLX_304 0% 44.7% 46.9% V5 (many diffs) n/a
3 TRCN0000475110 TGCGACTAACCGTGGCAGGCCAGT pLX_317 16.5% 44.7% 46.9% V5 (many diffs) n/a
Download CSV