Transcript: Human XM_024446025.1

PREDICTED: Homo sapiens polycystin 2 like 2, transient receptor potential cation channel (PKD2L2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PKD2L2 (27039)
Length:
1980
CDS:
32..1906

Additional Resources:

NCBI RefSeq record:
XM_024446025.1
NBCI Gene record:
PKD2L2 (27039)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446025.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056290 CTGGGATTCATGGTACAATAA pLKO.1 331 CDS 100% 13.200 9.240 N PKD2L2 n/a
2 TRCN0000056289 GCTGGCACATTTATTACAATA pLKO.1 1119 CDS 100% 13.200 9.240 N PKD2L2 n/a
3 TRCN0000415493 TCCTATCTTGGGACCCATTTA pLKO_005 1420 CDS 100% 13.200 9.240 N PKD2L2 n/a
4 TRCN0000424095 TGTTAGCTACTATGACTATTT pLKO_005 853 CDS 100% 13.200 9.240 N PKD2L2 n/a
5 TRCN0000056292 CAGGAATTGTTACTCTACTTT pLKO.1 119 CDS 100% 5.625 3.938 N PKD2L2 n/a
6 TRCN0000056291 CGAGAAATTCAGACTGAAGAA pLKO.1 1600 CDS 100% 4.950 3.465 N PKD2L2 n/a
7 TRCN0000056288 GCTGAATATGTTCTTGGCAAT pLKO.1 1477 CDS 100% 4.050 2.835 N PKD2L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446025.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11841 pDONR223 100% 83.7% 83.6% None 1146_1448del;1520T>C n/a
2 ccsbBroad304_11841 pLX_304 0% 83.7% 83.6% V5 1146_1448del;1520T>C n/a
3 TRCN0000465469 CCTGACATCCTCTCCATTGTTAGG pLX_317 25.2% 83.7% 83.6% V5 1146_1448del;1520T>C n/a
Download CSV