Transcript: Human XM_024446113.1

PREDICTED: Homo sapiens endoplasmic reticulum aminopeptidase 1 (ERAP1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ERAP1 (51752)
Length:
5341
CDS:
2407..5262

Additional Resources:

NCBI RefSeq record:
XM_024446113.1
NBCI Gene record:
ERAP1 (51752)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446113.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431357 TCTTAGTGCTGACGCATTTAA pLKO_005 3759 CDS 100% 15.000 12.000 N ERAP1 n/a
2 TRCN0000423012 GGGATAGTATGGCAAGTATTT pLKO_005 3842 CDS 100% 13.200 10.560 N ERAP1 n/a
3 TRCN0000060541 CCCACATGGTAATGGGTACAA pLKO.1 5021 CDS 100% 4.950 3.960 N ERAP1 n/a
4 TRCN0000060540 GCTCTGTTGTTTGATGCAGAA pLKO.1 3397 CDS 100% 4.050 2.835 N ERAP1 n/a
5 TRCN0000060542 CCTCACTGTTGGCTCTCTTAA pLKO.1 2459 CDS 100% 13.200 7.920 N ERAP1 n/a
6 TRCN0000031122 GCTTGTATTCTGAATATGCTA pLKO.1 3730 CDS 100% 3.000 1.800 N Erap1 n/a
7 TRCN0000324289 GCTTGTATTCTGAATATGCTA pLKO_005 3730 CDS 100% 3.000 1.800 N Erap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446113.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03378 pDONR223 100% 98.9% 98.8% None 2820_2824delTTCTC;2828_2853delinsG n/a
2 ccsbBroad304_03378 pLX_304 0% 98.9% 98.8% V5 2820_2824delTTCTC;2828_2853delinsG n/a
3 TRCN0000477517 AATGCAGTCTCAATCATATTCTAT pLX_317 16.4% 98.9% 98.8% V5 2820_2824delTTCTC;2828_2853delinsG n/a
Download CSV