Transcript: Human XM_024446191.1

PREDICTED: Homo sapiens solute carrier family 34 member 1 (SLC34A1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC34A1 (6569)
Length:
2415
CDS:
102..1853

Additional Resources:

NCBI RefSeq record:
XM_024446191.1
NBCI Gene record:
SLC34A1 (6569)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446191.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045033 CTTCTTCAACATCTCGGGTAT pLKO.1 1367 CDS 100% 4.050 2.835 N SLC34A1 n/a
2 TRCN0000045036 GTGGTTACAGACATGGGACTT pLKO.1 1646 CDS 100% 4.050 2.835 N SLC34A1 n/a
3 TRCN0000045034 GCTGGTGACATCTTCAAGGAT pLKO.1 498 CDS 100% 3.000 2.100 N SLC34A1 n/a
4 TRCN0000045035 CGAGTCTGTGATAACCAGCAT pLKO.1 947 CDS 100% 2.640 1.848 N SLC34A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446191.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06968 pDONR223 100% 91.1% 90.9% None 1006_1007ins168;1616G>C n/a
2 ccsbBroad304_06968 pLX_304 0% 91.1% 90.9% V5 1006_1007ins168;1616G>C n/a
3 TRCN0000474755 GTAAGGTGCCATCCTTACCCCAAG pLX_317 16.7% 91.1% 90.9% V5 1006_1007ins168;1616G>C n/a
Download CSV