Transcript: Human XM_024446271.1

PREDICTED: Homo sapiens zinc finger FYVE-type containing 16 (ZFYVE16), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZFYVE16 (9765)
Length:
7578
CDS:
3513..5696

Additional Resources:

NCBI RefSeq record:
XM_024446271.1
NBCI Gene record:
ZFYVE16 (9765)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446271.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057053 GCGAACTTCATTGCTCCCAAA pLKO.1 306 5UTR 100% 4.050 5.670 N ZFYVE16 n/a
2 TRCN0000369972 GATGAAATCCAGCCGTTATAT pLKO_005 487 5UTR 100% 15.000 12.000 N ZFYVE16 n/a
3 TRCN0000304075 ACTTGTTGACCTTCGAAATTA pLKO_005 4760 CDS 100% 15.000 10.500 N ZFYVE16 n/a
4 TRCN0000377421 TTTGAGGTCTTAGACTTATAA pLKO_005 6153 3UTR 100% 15.000 10.500 N ZFYVE16 n/a
5 TRCN0000304076 GGTCTATGTGTGGATCATTAA pLKO_005 1298 5UTR 100% 13.200 9.240 N ZFYVE16 n/a
6 TRCN0000304013 AGTATCTGCACTTAGGTATAC pLKO_005 5991 3UTR 100% 10.800 7.560 N ZFYVE16 n/a
7 TRCN0000057054 CCTGAGAGAATACGTGGATAT pLKO.1 5207 CDS 100% 10.800 7.560 N ZFYVE16 n/a
8 TRCN0000331240 CCTGAGAGAATACGTGGATAT pLKO_005 5207 CDS 100% 10.800 7.560 N ZFYVE16 n/a
9 TRCN0000057057 GCCAGCCATGTGGATTACTAA pLKO.1 950 5UTR 100% 5.625 3.938 N ZFYVE16 n/a
10 TRCN0000057056 CCAGATACAATAGAAAGTGAA pLKO.1 2164 5UTR 100% 4.950 3.465 N ZFYVE16 n/a
11 TRCN0000057055 CCTGTTACATTTGTCCTAAAT pLKO.1 4248 CDS 100% 13.200 7.920 N ZFYVE16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446271.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14026 pDONR223 100% 25.3% 25.2% None (many diffs) n/a
2 ccsbBroad304_14026 pLX_304 0% 25.3% 25.2% V5 (many diffs) n/a
3 TRCN0000478205 GGAGATGCCCGTTTCCACTAATGA pLX_317 7.8% 25.3% 25.2% V5 (many diffs) n/a
Download CSV