Transcript: Human XM_024446463.1

PREDICTED: Homo sapiens serpin family B member 6 (SERPINB6), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SERPINB6 (5269)
Length:
1516
CDS:
235..1377

Additional Resources:

NCBI RefSeq record:
XM_024446463.1
NBCI Gene record:
SERPINB6 (5269)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446463.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308260 ATGATGCGGTGTGCCAGATTC pLKO_005 1261 CDS 100% 10.800 15.120 N SERPINB6 n/a
2 TRCN0000052304 CCGCGGTTTAAACTAGAGGAA pLKO.1 1060 CDS 100% 2.640 3.696 N SERPINB6 n/a
3 TRCN0000052305 GCTGGGTAAAGACAACTCGAA pLKO.1 300 CDS 100% 2.640 3.696 N SERPINB6 n/a
4 TRCN0000052306 CTTGACTTTATCAGCGCCGTA pLKO.1 607 CDS 100% 2.160 3.024 N SERPINB6 n/a
5 TRCN0000052303 GCCCAGATACTTTCTTTCAAT pLKO.1 406 CDS 100% 5.625 4.500 N SERPINB6 n/a
6 TRCN0000290227 GCCCAGATACTTTCTTTCAAT pLKO_005 406 CDS 100% 5.625 4.500 N SERPINB6 n/a
7 TRCN0000052307 CAAATCTTGGTGCTTCCATAT pLKO.1 895 CDS 100% 10.800 7.560 N SERPINB6 n/a
8 TRCN0000290154 CAAATCTTGGTGCTTCCATAT pLKO_005 895 CDS 100% 10.800 7.560 N SERPINB6 n/a
9 TRCN0000296533 CCTGTGCAAATGATGTTTAAG pLKO_005 832 CDS 100% 13.200 7.920 N SERPINB6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446463.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06722 pDONR223 100% 98.8% 98.6% None 1_12del;280A>G n/a
2 ccsbBroad304_06722 pLX_304 0% 98.8% 98.6% V5 1_12del;280A>G n/a
3 TRCN0000466252 AACGCGGCGTAGACCCCGGAAGCT pLX_317 35.4% 98.8% 98.6% V5 1_12del;280A>G n/a
Download CSV