Transcript: Human XM_024446567.1

PREDICTED: Homo sapiens dystrobrevin binding protein 1 (DTNBP1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DTNBP1 (84062)
Length:
857
CDS:
29..685

Additional Resources:

NCBI RefSeq record:
XM_024446567.1
NBCI Gene record:
DTNBP1 (84062)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446567.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379485 AGATGGACCTGATGGACATAT pLKO_005 348 CDS 100% 13.200 9.240 N DTNBP1 n/a
2 TRCN0000382040 GGTGAGGACAGCGACTCTTAA pLKO_005 665 CDS 100% 13.200 9.240 N DTNBP1 n/a
3 TRCN0000083303 ACCTGGAAAGCCAGGTTGTTT pLKO.1 747 3UTR 100% 0.563 0.394 N DTNBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446567.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04321 pDONR223 100% 57.3% 52.9% None (many diffs) n/a
2 ccsbBroad304_04321 pLX_304 0% 57.3% 52.9% V5 (many diffs) n/a
3 TRCN0000471667 TTTCATTCTTTTATTCTGTCTATA pLX_317 38.9% 57.3% 52.9% V5 (many diffs) n/a
Download CSV