Transcript: Human XM_024446634.1

PREDICTED: Homo sapiens component of oligomeric golgi complex 5 (COG5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COG5 (10466)
Length:
2193
CDS:
373..2103

Additional Resources:

NCBI RefSeq record:
XM_024446634.1
NBCI Gene record:
COG5 (10466)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446634.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415199 GATTTGCTTCGGAGGATTATT pLKO_005 892 CDS 100% 15.000 21.000 N COG5 n/a
2 TRCN0000431446 GGAACTTTGAAGGATACTATT pLKO_005 1180 CDS 100% 13.200 10.560 N COG5 n/a
3 TRCN0000151694 CATGAAGATTTACTGGCACAA pLKO.1 712 CDS 100% 4.050 3.240 N COG5 n/a
4 TRCN0000151644 CTGTTGATACAAACCTCACAT pLKO.1 1958 CDS 100% 4.950 3.465 N COG5 n/a
5 TRCN0000150514 GCTTTGAAAGACTCACTACAA pLKO.1 1789 CDS 100% 4.950 3.465 N COG5 n/a
6 TRCN0000155224 GCCAAGAAGAGAGATCCTGTT pLKO.1 1438 CDS 100% 4.050 2.835 N COG5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446634.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07615 pDONR223 100% 69.1% 66.6% None (many diffs) n/a
2 ccsbBroad304_07615 pLX_304 0% 69.1% 66.6% V5 (many diffs) n/a
3 TRCN0000472725 ATCGAACCCCTACATTTCATGAGG pLX_317 17.5% 69.1% 66.6% V5 (many diffs) n/a
Download CSV