Transcript: Human XM_024446646.1

PREDICTED: Homo sapiens zona pellucida binding protein (ZPBP), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZPBP (11055)
Length:
1388
CDS:
466..1296

Additional Resources:

NCBI RefSeq record:
XM_024446646.1
NBCI Gene record:
ZPBP (11055)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136509 CTGAACTGATAGACCCATCAT pLKO.1 521 CDS 100% 4.950 6.930 N ZPBP n/a
2 TRCN0000135650 GTTGGACACTTGGTTCGATTA pLKO.1 370 5UTR 100% 10.800 8.640 N ZPBP n/a
3 TRCN0000134336 GTTTGGATTAATCGCTGCTTT pLKO.1 1129 CDS 100% 4.950 3.465 N ZPBP n/a
4 TRCN0000133744 CACAAATAACATCCACAGGAA pLKO.1 590 CDS 100% 2.640 1.848 N ZPBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07736 pDONR223 100% 78.5% 78.3% None 0_1ins222;110_111insAGT;823T>A n/a
2 ccsbBroad304_07736 pLX_304 0% 78.5% 78.3% V5 0_1ins222;110_111insAGT;823T>A n/a
3 TRCN0000471387 CGCACTGGGAAAGATAGGCTACGC pLX_317 46% 78.5% 78.3% V5 0_1ins222;110_111insAGT;823T>A n/a
Download CSV