Transcript: Human XM_024447220.1

PREDICTED: Homo sapiens zinc finger protein 250 (ZNF250), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF250 (58500)
Length:
3532
CDS:
1211..2893

Additional Resources:

NCBI RefSeq record:
XM_024447220.1
NBCI Gene record:
ZNF250 (58500)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447220.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244353 TTGAGTCCGAAGCCATTAATT pLKO_005 1607 CDS 100% 15.000 21.000 N ZNF250 n/a
2 TRCN0000017846 GACTACTCAGACAACCTCAAA pLKO.1 1499 CDS 100% 4.950 6.930 N ZNF250 n/a
3 TRCN0000244352 TACTCAGACAACCTCAAATAT pLKO_005 1502 CDS 100% 15.000 10.500 N ZNF250 n/a
4 TRCN0000244351 CCGTGAAGTTCAGGTCTTAAG pLKO_005 1732 CDS 100% 10.800 7.560 N ZNF250 n/a
5 TRCN0000017844 CACCGTGAAGTTCAGGTCTTA pLKO.1 1730 CDS 100% 4.950 3.465 N ZNF250 n/a
6 TRCN0000017845 CAGCCTGAAAGCAACTCTGAT pLKO.1 2674 CDS 100% 4.950 3.465 N ZNF250 n/a
7 TRCN0000017843 CCTATGGGAATGTAGTCTCAT pLKO.1 1371 CDS 100% 4.950 3.465 N ZNF250 n/a
8 TRCN0000017847 CTTGCTCAGCATCACAAGATA pLKO.1 2018 CDS 100% 5.625 3.375 N ZNF250 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447220.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12415 pDONR223 100% 91% 91% None 1_150del n/a
2 ccsbBroad304_12415 pLX_304 0% 91% 91% V5 1_150del n/a
3 TRCN0000481370 TGAACCCTTGAATGACGCTTCCCC pLX_317 31% 91% 91% V5 1_150del n/a
Download CSV