Transcript: Human XM_024447305.1

PREDICTED: Homo sapiens phospholipid phosphatase 5 (PLPP5), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLPP5 (84513)
Length:
4341
CDS:
1289..1687

Additional Resources:

NCBI RefSeq record:
XM_024447305.1
NBCI Gene record:
PLPP5 (84513)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447305.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295998 CTACGTGGAGGCGGAGTATTT pLKO_005 118 5UTR 100% 13.200 18.480 N PLPP5 n/a
2 TRCN0000040238 CGTCTTTACCAACACAATAAA pLKO.1 1107 5UTR 100% 15.000 12.000 N PLPP5 n/a
3 TRCN0000298906 CGTCTTTACCAACACAATAAA pLKO_005 1107 5UTR 100% 15.000 12.000 N PLPP5 n/a
4 TRCN0000296043 TGATCTTCCTGGCCAAATTTC pLKO_005 606 5UTR 100% 13.200 9.240 N PLPP5 n/a
5 TRCN0000040239 CCTTTCTGTCACCTCTACTTT pLKO.1 1452 CDS 100% 5.625 3.938 N PLPP5 n/a
6 TRCN0000040242 GACACAAGAGACAGCAGACAA pLKO.1 638 5UTR 100% 4.950 3.465 N PLPP5 n/a
7 TRCN0000298907 GACACAAGAGACAGCAGACAA pLKO_005 638 5UTR 100% 4.950 3.465 N PLPP5 n/a
8 TRCN0000040240 CCCAGTGGACATTCTTCCTTT pLKO.1 1337 CDS 100% 4.950 2.970 N PLPP5 n/a
9 TRCN0000080722 TCTGTGCCTTTCTGTCACCTT pLKO.1 1446 CDS 100% 2.640 1.584 N Plpp5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447305.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12825 pDONR223 100% 59.1% 59.1% None 0_1ins273 n/a
2 ccsbBroad304_12825 pLX_304 0% 59.1% 59.1% V5 0_1ins273 n/a
3 TRCN0000467220 ATTTTGTGCCGACTTTTCAACGTC pLX_317 59.3% 59.1% 59.1% V5 0_1ins273 n/a
4 ccsbBroadEn_16036 pDONR223 0% 37% 35.4% None (many diffs) n/a
5 ccsbBroad304_16036 pLX_304 0% 37% 35.4% V5 (many diffs) n/a
Download CSV