Transcript: Human XM_024447483.1

PREDICTED: Homo sapiens ankyrin repeat domain 18A (ANKRD18A), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD18A (253650)
Length:
6532
CDS:
305..3817

Additional Resources:

NCBI RefSeq record:
XM_024447483.1
NBCI Gene record:
ANKRD18A (253650)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447483.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000204219 CGGAGAAACAGCGGATGAAAT pLKO.1 3087 CDS 100% 13.200 9.240 N ANKRD18A n/a
2 TRCN0000186825 GAGCAGTGAAAGCTAACAATT pLKO.1 3003 CDS 100% 13.200 9.240 N ANKRD18A n/a
3 TRCN0000203022 GAAGAATTTAAGGAAGCCTTT pLKO.1 2978 CDS 100% 4.050 2.430 N ANKRD18A n/a
4 TRCN0000187188 CCAGAGTTACCTTGTGTTGAA pLKO.1 3140 CDS 100% 4.950 2.475 Y ANKRD18A n/a
5 TRCN0000203883 CTACTTCAAACCCACAGACTT pLKO.1 3219 CDS 100% 4.950 2.475 Y ANKRD18A n/a
6 TRCN0000203324 GACTTCAAATAACTGCAAGAA pLKO.1 3235 CDS 100% 4.950 2.475 Y ANKRD18A n/a
7 TRCN0000163478 GCCTTGGGAAGTCATTCTCAA pLKO.1 3776 CDS 100% 4.950 2.475 Y ANKRD18B n/a
8 TRCN0000159733 GCTAAAGAAAGTCAATCCATT pLKO.1 1892 CDS 100% 4.950 2.475 Y ANKRD18B n/a
9 TRCN0000138852 GCTCTCCATTATGCCGTGTAT pLKO.1 713 CDS 100% 4.950 2.475 Y ANKRD20A3 n/a
10 TRCN0000151931 CCATGCAAATATTGAAGCACT pLKO.1 772 CDS 100% 2.640 1.320 Y ANKRD19P n/a
11 TRCN0000157785 CAGATCGACATCTGTGACAGA pLKO.1 581 CDS 100% 0.264 0.132 Y ANKRD18DP n/a
12 TRCN0000162695 CAAGAAGAACTGGTCGATCAT pLKO.1 2177 CDS 100% 4.950 2.475 Y ANKRD18B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447483.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09894 pDONR223 100% 84.6% 84.1% None (many diffs) n/a
2 ccsbBroad304_09894 pLX_304 0% 84.6% 84.1% V5 (many diffs) n/a
3 TRCN0000475606 CCGGTTCTGATATGTTTTATAAAT pLX_317 11.9% 84.6% 84.1% V5 (many diffs) n/a
Download CSV