Transcript: Human XM_024447509.1

PREDICTED: Homo sapiens F-box and WD repeat domain containing 2 (FBXW2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBXW2 (26190)
Length:
6720
CDS:
189..1358

Additional Resources:

NCBI RefSeq record:
XM_024447509.1
NBCI Gene record:
FBXW2 (26190)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447509.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306720 ACATGCTGCCTCGTCTCTAAA pLKO_005 423 CDS 100% 13.200 9.240 N FBXW2 n/a
2 TRCN0000006548 GCCTTTGAAACCTCGTCATTA pLKO.1 600 CDS 100% 13.200 9.240 N FBXW2 n/a
3 TRCN0000293437 GCCTTTGAAACCTCGTCATTA pLKO_005 600 CDS 100% 13.200 9.240 N FBXW2 n/a
4 TRCN0000298510 TCACGCAGTGCACAATCATTT pLKO_005 1469 3UTR 100% 13.200 9.240 N FBXW2 n/a
5 TRCN0000006546 GAACCAAAGTTCTCACCTAAT pLKO.1 1441 3UTR 100% 10.800 7.560 N FBXW2 n/a
6 TRCN0000006549 GCAGACTTCACTGTGAAAGTA pLKO.1 729 CDS 100% 5.625 3.938 N FBXW2 n/a
7 TRCN0000012815 CCTGGAGACTACATCCTCTTA pLKO.1 855 CDS 100% 4.950 3.465 N Fbxw2 n/a
8 TRCN0000353103 CCTGGAGACTACATCCTCTTA pLKO_005 855 CDS 100% 4.950 3.465 N Fbxw2 n/a
9 TRCN0000006547 GCAAATACATTGTCTGTAGTT pLKO.1 1000 CDS 100% 4.950 3.465 N FBXW2 n/a
10 TRCN0000012816 CCACAGTATTCACCTGGTGTT pLKO.1 1319 CDS 100% 4.050 2.835 N Fbxw2 n/a
11 TRCN0000345046 CCACAGTATTCACCTGGTGTT pLKO_005 1319 CDS 100% 4.050 2.835 N Fbxw2 n/a
12 TRCN0000165774 CCTCCTAAGTAGCTGGGATTA pLKO.1 3679 3UTR 100% 10.800 5.400 Y SNX29P1 n/a
13 TRCN0000012813 GAACCAAAGTTCTCACCTAAA pLKO.1 1441 3UTR 100% 10.800 7.560 N Fbxw2 n/a
14 TRCN0000344974 GAACCAAAGTTCTCACCTAAA pLKO_005 1441 3UTR 100% 10.800 7.560 N Fbxw2 n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3817 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000157407 GATCTCGGCTTACTGCAACTT pLKO.1 5335 3UTR 100% 4.950 2.475 Y GTF2IRD2B n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3817 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447509.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02929 pDONR223 100% 85.6% 85.6% None 489_490ins195 n/a
2 ccsbBroad304_02929 pLX_304 0% 85.6% 85.6% V5 489_490ins195 n/a
Download CSV