Transcript: Human XM_024447592.1

PREDICTED: Homo sapiens nicotinamide riboside kinase 1 (NMRK1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NMRK1 (54981)
Length:
1974
CDS:
464..1003

Additional Resources:

NCBI RefSeq record:
XM_024447592.1
NBCI Gene record:
NMRK1 (54981)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447592.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360130 CAGACTCTCCGGGATACTTTG pLKO_005 813 CDS 100% 10.800 15.120 N NMRK1 n/a
2 TRCN0000160469 CCCAACATGTGGAACAATAAA pLKO.1 1146 3UTR 100% 15.000 10.500 N NMRK1 n/a
3 TRCN0000360128 GGAAACTCCAAGGAGTAATTT pLKO_005 1040 3UTR 100% 15.000 10.500 N NMRK1 n/a
4 TRCN0000360129 GCAAGTATATGAAGATCTAAT pLKO_005 940 CDS 100% 13.200 9.240 N NMRK1 n/a
5 TRCN0000160781 CAAGACACTCTGTGGTATCAA pLKO.1 705 CDS 100% 5.625 3.938 N NMRK1 n/a
6 TRCN0000134781 CCTTCACCAAGATACAATGTA pLKO.1 1066 3UTR 100% 5.625 3.938 N NMRK1 n/a
7 TRCN0000160349 CTTGAAGCACTTAACATGGAA pLKO.1 647 CDS 100% 3.000 2.100 N NMRK1 n/a
8 TRCN0000134780 CTTCCTGAAGTGAATTAGGAA pLKO.1 1023 3UTR 100% 0.300 0.210 N NMRK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447592.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03503 pDONR223 100% 95.3% 91.3% None (many diffs) n/a
2 ccsbBroadEn_08439 pDONR223 100% 84.1% 80.2% None (many diffs) n/a
3 ccsbBroad304_08439 pLX_304 0% 84.1% 80.2% V5 (many diffs) n/a
4 TRCN0000479031 ACCAACATCTGTTACATTGGCACC pLX_317 63.3% 84.1% 80.2% V5 (many diffs) n/a
5 ccsbBroadEn_15086 pDONR223 0% 84.1% 80.2% None (many diffs) n/a
6 ccsbBroad304_15086 pLX_304 0% 84.1% 80.2% V5 (many diffs) n/a
7 TRCN0000475200 GATGTGATACCGATATATACTCCC pLX_317 64% 84.1% 80.2% V5 (many diffs) n/a
Download CSV