Transcript: Human XM_024447607.1

PREDICTED: Homo sapiens protein phosphatase 6 catalytic subunit (PPP6C), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPP6C (5537)
Length:
3819
CDS:
316..792

Additional Resources:

NCBI RefSeq record:
XM_024447607.1
NBCI Gene record:
PPP6C (5537)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447607.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002766 CCAAAGTTATTCCGGGCAGTT pLKO.1 718 CDS 100% 4.050 5.670 N PPP6C n/a
2 TRCN0000002768 GCTTATTTACTGGTCTGGGAA pLKO.1 1070 3UTR 100% 2.640 3.696 N PPP6C n/a
3 TRCN0000279949 GCTTATTTACTGGTCTGGGAA pLKO_005 1070 3UTR 100% 2.640 3.696 N PPP6C n/a
4 TRCN0000379835 CTAGTGCACGAAGGCTATAAA pLKO_005 589 CDS 100% 0.000 0.000 N PPP6C n/a
5 TRCN0000002767 GCTTCGATCATGGTCTTCAAA pLKO.1 679 CDS 100% 5.625 3.938 N PPP6C n/a
6 TRCN0000297274 GCTTCGATCATGGTCTTCAAA pLKO_005 679 CDS 100% 5.625 3.938 N PPP6C n/a
7 TRCN0000080924 GCCTGGAGATACTGTACCAAA pLKO.1 286 5UTR 100% 4.950 3.465 N Ppp6c n/a
8 TRCN0000002764 GAGTCAAATGTTCAGCCAGTA pLKO.1 194 5UTR 100% 4.050 2.835 N PPP6C n/a
9 TRCN0000279950 GAGTCAAATGTTCAGCCAGTA pLKO_005 194 5UTR 100% 4.050 2.835 N PPP6C n/a
10 TRCN0000002765 CCAGAACGACAACGCCATATT pLKO.1 764 CDS 100% 13.200 7.920 N PPP6C n/a
11 TRCN0000279890 CCAGAACGACAACGCCATATT pLKO_005 764 CDS 100% 13.200 7.920 N PPP6C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447607.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01270 pDONR223 100% 51.8% 51.8% None 0_1ins441 n/a
2 ccsbBroad304_01270 pLX_304 0% 51.8% 51.8% V5 0_1ins441 n/a
3 TRCN0000471947 TCAGAATCTGCTTTGTGTCTCCAA pLX_317 45.2% 51.8% 51.8% V5 0_1ins441 n/a
Download CSV