Transcript: Human XM_024447654.1

PREDICTED: Homo sapiens 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 (PFKFB2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PFKFB2 (5208)
Length:
7071
CDS:
108..1625

Additional Resources:

NCBI RefSeq record:
XM_024447654.1
NBCI Gene record:
PFKFB2 (5208)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024879 CCCACCAAAGTGTTTAATCTT pLKO.1 309 CDS 100% 5.625 7.875 N Pfkfb2 n/a
2 TRCN0000037960 CCCGACTCTGATCGTTATGAT pLKO.1 218 CDS 100% 5.625 7.875 N PFKFB2 n/a
3 TRCN0000333372 CCCGACTCTGATCGTTATGAT pLKO_005 218 CDS 100% 5.625 7.875 N PFKFB2 n/a
4 TRCN0000037963 CGACTTCTTTCGGCATGACAA pLKO.1 371 CDS 100% 4.950 6.930 N PFKFB2 n/a
5 TRCN0000037961 CGAATACAATAAGGCGTCCAA pLKO.1 1525 CDS 100% 2.640 3.696 N PFKFB2 n/a
6 TRCN0000024880 CGTCCAAGAAATTACAGTGTT pLKO.1 1539 CDS 100% 4.950 3.960 N Pfkfb2 n/a
7 TRCN0000219781 GAATTGTGTCCAGGGATTTAA pLKO.1 5812 3UTR 100% 15.000 10.500 N PFKFB2 n/a
8 TRCN0000194876 CCATGTTGTGTTCATTGTTAA pLKO.1 5667 3UTR 100% 13.200 9.240 N PFKFB2 n/a
9 TRCN0000197208 GAAGCAGTCAAGTCCTATAAG pLKO.1 345 CDS 100% 13.200 9.240 N PFKFB2 n/a
10 TRCN0000219780 CAACTATGACAAGGATCTTTC pLKO.1 728 CDS 100% 10.800 7.560 N PFKFB2 n/a
11 TRCN0000196381 GAGAAGTATCTGTATCGATAT pLKO.1 1167 CDS 100% 10.800 7.560 N PFKFB2 n/a
12 TRCN0000344808 GAGAAGTATCTGTATCGATAT pLKO_005 1167 CDS 100% 10.800 7.560 N PFKFB2 n/a
13 TRCN0000037962 CCAGAGCAAGATAGTCTACTA pLKO.1 809 CDS 100% 4.950 3.465 N PFKFB2 n/a
14 TRCN0000333303 CCAGAGCAAGATAGTCTACTA pLKO_005 809 CDS 100% 4.950 3.465 N PFKFB2 n/a
15 TRCN0000037959 CCTGATGTCATTGCTGCCAAT pLKO.1 588 CDS 100% 4.050 2.835 N PFKFB2 n/a
16 TRCN0000333302 CCTGATGTCATTGCTGCCAAT pLKO_005 588 CDS 100% 4.050 2.835 N PFKFB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14743 pDONR223 100% 98.6% 48.8% None (many diffs) n/a
2 ccsbBroad304_14743 pLX_304 0% 98.6% 48.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV