Transcript: Human XM_024447656.1

PREDICTED: Homo sapiens 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 (PFKFB2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PFKFB2 (5208)
Length:
9067
CDS:
2203..3621

Additional Resources:

NCBI RefSeq record:
XM_024447656.1
NBCI Gene record:
PFKFB2 (5208)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147260 AAATAACAGACCTCAAAGTG pXPR_003 TGG 795 56% 9 0.4713 PFKFB2 PFKFB2 77687
2 BRDN0001145863 TGTTAAGGCGTATCTCACTG pXPR_003 AGG 253 18% 4 0.243 PFKFB2 PFKFB2 77685
3 BRDN0001146926 AATCATAACGATCAGAGTCG pXPR_003 GGG 16 1% 2 -0.0413 PFKFB2 PFKFB2 77686
4 BRDN0001147256 AAAGCGAGTTCAATCTCTTG pXPR_003 GGG 693 49% 8 -0.0416 PFKFB2 PFKFB2 77688
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447656.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024879 CCCACCAAAGTGTTTAATCTT pLKO.1 2305 CDS 100% 5.625 7.875 N Pfkfb2 n/a
2 TRCN0000037960 CCCGACTCTGATCGTTATGAT pLKO.1 2214 CDS 100% 5.625 7.875 N PFKFB2 n/a
3 TRCN0000333372 CCCGACTCTGATCGTTATGAT pLKO_005 2214 CDS 100% 5.625 7.875 N PFKFB2 n/a
4 TRCN0000037963 CGACTTCTTTCGGCATGACAA pLKO.1 2367 CDS 100% 4.950 6.930 N PFKFB2 n/a
5 TRCN0000037961 CGAATACAATAAGGCGTCCAA pLKO.1 3521 CDS 100% 2.640 3.696 N PFKFB2 n/a
6 TRCN0000024880 CGTCCAAGAAATTACAGTGTT pLKO.1 3535 CDS 100% 4.950 3.960 N Pfkfb2 n/a
7 TRCN0000219781 GAATTGTGTCCAGGGATTTAA pLKO.1 7808 3UTR 100% 15.000 10.500 N PFKFB2 n/a
8 TRCN0000194876 CCATGTTGTGTTCATTGTTAA pLKO.1 7663 3UTR 100% 13.200 9.240 N PFKFB2 n/a
9 TRCN0000197208 GAAGCAGTCAAGTCCTATAAG pLKO.1 2341 CDS 100% 13.200 9.240 N PFKFB2 n/a
10 TRCN0000219780 CAACTATGACAAGGATCTTTC pLKO.1 2724 CDS 100% 10.800 7.560 N PFKFB2 n/a
11 TRCN0000196381 GAGAAGTATCTGTATCGATAT pLKO.1 3163 CDS 100% 10.800 7.560 N PFKFB2 n/a
12 TRCN0000344808 GAGAAGTATCTGTATCGATAT pLKO_005 3163 CDS 100% 10.800 7.560 N PFKFB2 n/a
13 TRCN0000037962 CCAGAGCAAGATAGTCTACTA pLKO.1 2805 CDS 100% 4.950 3.465 N PFKFB2 n/a
14 TRCN0000333303 CCAGAGCAAGATAGTCTACTA pLKO_005 2805 CDS 100% 4.950 3.465 N PFKFB2 n/a
15 TRCN0000037959 CCTGATGTCATTGCTGCCAAT pLKO.1 2584 CDS 100% 4.050 2.835 N PFKFB2 n/a
16 TRCN0000333302 CCTGATGTCATTGCTGCCAAT pLKO_005 2584 CDS 100% 4.050 2.835 N PFKFB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447656.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14743 pDONR223 100% 92.1% 42.3% None (many diffs) n/a
2 ccsbBroad304_14743 pLX_304 0% 92.1% 42.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV