Transcript: Human XM_024447701.1

PREDICTED: Homo sapiens post-GPI attachment to proteins GalNAc transferase 4 (PGAP4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PGAP4 (84302)
Length:
4089
CDS:
160..1371

Additional Resources:

NCBI RefSeq record:
XM_024447701.1
NBCI Gene record:
PGAP4 (84302)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447701.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437256 GGAGCGTAGTGTGAGCCATTT pLKO_005 597 CDS 100% 10.800 15.120 N PGAP4 n/a
2 TRCN0000121560 CCGACTTCTACACTCTTACTT pLKO.1 291 CDS 100% 5.625 7.875 N PGAP4 n/a
3 TRCN0000142500 GACTACGTCCTGATGGTAGAA pLKO.1 772 CDS 100% 4.950 6.930 N PGAP4 n/a
4 TRCN0000122071 CTTACTTCTATCTGCGCCATT pLKO.1 305 CDS 100% 4.050 3.240 N PGAP4 n/a
5 TRCN0000413734 AGGGCACTGAGGATGATTATG pLKO_005 665 CDS 100% 13.200 9.240 N PGAP4 n/a
6 TRCN0000142518 GAGGGCACTGAGGATGATTAT pLKO.1 664 CDS 100% 13.200 9.240 N PGAP4 n/a
7 TRCN0000443634 GGCTCCAGCACTACATCAATC pLKO_005 908 CDS 100% 10.800 7.560 N PGAP4 n/a
8 TRCN0000145417 GCCACTTCTTGAAGATTCAAA pLKO.1 1400 3UTR 100% 5.625 3.938 N PGAP4 n/a
9 TRCN0000142198 GCAAAGCTTGAAAGAGGGTGA pLKO.1 360 CDS 100% 2.160 1.512 N PGAP4 n/a
10 TRCN0000142267 GCCAAGAGATGCCTTTCTGAA pLKO.1 1375 3UTR 100% 4.950 2.970 N PGAP4 n/a
11 TRCN0000122150 GCCCTTTATCTCAAGCTGTAT pLKO.1 877 CDS 100% 4.950 2.970 N PGAP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447701.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04365 pDONR223 100% 99.9% 100% None 54C>G n/a
2 ccsbBroad304_04365 pLX_304 0% 99.9% 100% V5 54C>G n/a
3 TRCN0000465885 TCGTTTCTTTTATGTTATAGGCAA pLX_317 31.5% 99.9% 100% V5 54C>G n/a
Download CSV