Transcript: Human XM_024447865.1

PREDICTED: Homo sapiens protoporphyrinogen oxidase (PPOX), transcript variant X22, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPOX (5498)
Length:
2446
CDS:
566..1732

Additional Resources:

NCBI RefSeq record:
XM_024447865.1
NBCI Gene record:
PPOX (5498)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447865.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381709 GCCCTAATGGTGCTATCTTTG pLKO_005 281 5UTR 100% 10.800 15.120 N PPOX n/a
2 TRCN0000045983 GACCACGTTATTAGTGCCATT pLKO.1 995 CDS 100% 4.050 3.240 N PPOX n/a
3 TRCN0000045987 GCAAACCCATCGTTCCATATT pLKO.1 730 CDS 100% 13.200 9.240 N PPOX n/a
4 TRCN0000298237 GCAAACCCATCGTTCCATATT pLKO_005 730 CDS 100% 13.200 9.240 N PPOX n/a
5 TRCN0000293905 GCGCTGGAAGGTATCTCTAAG pLKO_005 955 CDS 100% 10.800 7.560 N PPOX n/a
6 TRCN0000045985 AGGCCCTAATGGTGCTATCTT pLKO.1 279 5UTR 100% 5.625 3.938 N PPOX n/a
7 TRCN0000045984 CGTGTATGACTCAGTTGCTTT pLKO.1 1195 CDS 100% 4.950 3.465 N PPOX n/a
8 TRCN0000286469 CGTGTATGACTCAGTTGCTTT pLKO_005 1195 CDS 100% 4.950 3.465 N PPOX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447865.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01257 pDONR223 100% 56.6% 51.1% None (many diffs) n/a
2 ccsbBroad304_01257 pLX_304 0% 56.6% 51.1% V5 (many diffs) n/a
3 TRCN0000469068 ATATATTCTCGATTAGGTCAAACG pLX_317 33.7% 56.6% 51.1% V5 (many diffs) n/a
Download CSV