Transcript: Human XM_024447933.1

PREDICTED: Homo sapiens HECT and RLD domain containing E3 ubiquitin protein ligase 4 (HERC4), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HERC4 (26091)
Length:
2439
CDS:
616..948

Additional Resources:

NCBI RefSeq record:
XM_024447933.1
NBCI Gene record:
HERC4 (26091)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447933.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447933.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10792 pDONR223 100% 20.1% 17.1% None (many diffs) n/a
2 ccsbBroad304_10792 pLX_304 0% 20.1% 17.1% V5 (many diffs) n/a
3 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 20.1% 17.1% V5 (many diffs) n/a
4 ccsbBroadEn_02913 pDONR223 100% 9.3% 7.5% None (many diffs) n/a
5 ccsbBroad304_02913 pLX_304 0% 9.3% 7.5% V5 (many diffs) n/a
6 TRCN0000470694 GCTTGAAGCTGGCGCGCCCGTGAT pLX_317 11.2% 9.3% 7.5% V5 (many diffs) n/a
Download CSV