Transcript: Human XM_024447968.1

PREDICTED: Homo sapiens helicase, lymphoid specific (HELLS), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HELLS (3070)
Length:
13256
CDS:
145..2799

Additional Resources:

NCBI RefSeq record:
XM_024447968.1
NBCI Gene record:
HELLS (3070)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447968.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000310 GAATATGAAGTGCCGTCTAAT pLKO.1 1224 CDS 100% 13.200 18.480 N HELLS n/a
2 TRCN0000273218 GAATATGAAGTGCCGTCTAAT pLKO_005 1224 CDS 100% 13.200 18.480 N HELLS n/a
3 TRCN0000000308 GTTGTTGTTTATCGCCTTGTT pLKO.1 2431 CDS 100% 4.950 6.930 N HELLS n/a
4 TRCN0000000307 GCCAGATGTATTTGATGACTT pLKO.1 1347 CDS 100% 4.950 3.960 N HELLS n/a
5 TRCN0000273143 GCCAGATGTATTTGATGACTT pLKO_005 1347 CDS 100% 4.950 3.960 N HELLS n/a
6 TRCN0000273147 GAACAAAGAAGTATCCATATT pLKO_005 2966 3UTR 100% 13.200 9.240 N HELLS n/a
7 TRCN0000273217 GATCAAGAGAGAAGGTCATTA pLKO_005 2639 CDS 100% 13.200 9.240 N HELLS n/a
8 TRCN0000000306 GAAGTGAATATCCCTGTAGAA pLKO.1 1921 CDS 100% 4.950 3.465 N HELLS n/a
9 TRCN0000273219 GAAGTGAATATCCCTGTAGAA pLKO_005 1921 CDS 100% 4.950 3.465 N HELLS n/a
10 TRCN0000000309 TCCAGTGAGAAAGAAACAATT pLKO.1 1762 CDS 100% 13.200 7.920 N HELLS n/a
11 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 5154 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 9159 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 9159 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447968.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10871 pDONR223 100% 39.3% 39.3% None 1_1608del n/a
2 ccsbBroad304_10871 pLX_304 0% 39.3% 39.3% V5 1_1608del n/a
3 TRCN0000478779 TCTCAGACAGATCTATGCCGGTGC pLX_317 27.1% 39.3% 39.3% V5 1_1608del n/a
Download CSV