Transcript: Human XM_024448090.1

PREDICTED: Homo sapiens semaphorin 4G (SEMA4G), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEMA4G (57715)
Length:
4725
CDS:
707..3238

Additional Resources:

NCBI RefSeq record:
XM_024448090.1
NBCI Gene record:
SEMA4G (57715)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448090.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061138 CCCTATATGGAATACCAGGAT pLKO.1 1757 CDS 100% 2.640 3.696 N SEMA4G n/a
2 TRCN0000291254 CCCTATATGGAATACCAGGAT pLKO_005 1757 CDS 100% 2.640 3.696 N SEMA4G n/a
3 TRCN0000061140 GCTCGTGTATCACAGATTCAT pLKO.1 1830 CDS 100% 5.625 3.938 N SEMA4G n/a
4 TRCN0000291198 GCTCGTGTATCACAGATTCAT pLKO_005 1830 CDS 100% 5.625 3.938 N SEMA4G n/a
5 TRCN0000061139 CCTACCTATGACCTGCTCTTT pLKO.1 2027 CDS 100% 4.950 3.465 N SEMA4G n/a
6 TRCN0000291196 CCTACCTATGACCTGCTCTTT pLKO_005 2027 CDS 100% 4.950 3.465 N SEMA4G n/a
7 TRCN0000061142 CTGCTCTATGTGCTAGCCATT pLKO.1 2744 CDS 100% 4.050 2.835 N SEMA4G n/a
8 TRCN0000061141 CCCTCGGATGACCATACCCTA pLKO.1 805 CDS 100% 0.880 0.616 N SEMA4G n/a
9 TRCN0000291195 CCCTCGGATGACCATACCCTA pLKO_005 805 CDS 100% 0.880 0.616 N SEMA4G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448090.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15953 pDONR223 0% 77.1% 64.9% None (many diffs) n/a
2 ccsbBroad304_15953 pLX_304 0% 77.1% 64.9% V5 (many diffs) n/a
3 TRCN0000475425 CGATCATCTGTGATCATAAGCCCA pLX_317 10.8% 77.1% 64.9% V5 (many diffs) n/a
Download CSV