Transcript: Human XM_024448321.1

PREDICTED: Homo sapiens T cell immune regulator 1, ATPase H+ transporting V0 subunit a3 (TCIRG1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TCIRG1 (10312)
Length:
2954
CDS:
291..2876

Additional Resources:

NCBI RefSeq record:
XM_024448321.1
NBCI Gene record:
TCIRG1 (10312)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448321.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038634 AGACGCTTTGTGGTTGATGTT pLKO.1 435 CDS 100% 4.950 3.465 N TCIRG1 n/a
2 TRCN0000289222 AGACGCTTTGTGGTTGATGTT pLKO_005 435 CDS 100% 4.950 3.465 N TCIRG1 n/a
3 TRCN0000038636 CCTCGTGTTCCTAGTCATCTA pLKO.1 2132 CDS 100% 4.950 3.465 N TCIRG1 n/a
4 TRCN0000289300 CCTCGTGTTCCTAGTCATCTA pLKO_005 2132 CDS 100% 4.950 3.465 N TCIRG1 n/a
5 TRCN0000038637 CCACAAGATGAAGGCCGTGTA pLKO.1 1194 CDS 100% 4.050 2.835 N TCIRG1 n/a
6 TRCN0000307047 CCACAAGATGAAGGCCGTGTA pLKO_005 1194 CDS 100% 4.050 2.835 N TCIRG1 n/a
7 TRCN0000038638 CAACTCCTTCAAGATGAAGAT pLKO.1 1973 CDS 100% 4.950 2.970 N TCIRG1 n/a
8 TRCN0000289223 CAACTCCTTCAAGATGAAGAT pLKO_005 1973 CDS 100% 4.950 2.970 N TCIRG1 n/a
9 TRCN0000101699 GAGTTCAGAGACCTCAACGAA pLKO.1 396 CDS 100% 3.000 2.100 N Tcirg1 n/a
10 TRCN0000038635 CCGCAAGATCACGGACTGCTT pLKO.1 986 CDS 100% 0.880 0.616 N TCIRG1 n/a
11 TRCN0000289299 CCGCAAGATCACGGACTGCTT pLKO_005 986 CDS 100% 0.880 0.616 N TCIRG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448321.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02396 pDONR223 100% 96.3% 67% None 713_728del;1261G>C;1478_1554del n/a
2 ccsbBroad304_02396 pLX_304 0% 96.3% 67% V5 713_728del;1261G>C;1478_1554del n/a
3 TRCN0000471826 TCCGTTCCGAGGCATCACTTCAGT pLX_317 14.9% 96.3% 67% V5 713_728del;1261G>C;1478_1554del n/a
Download CSV