Transcript: Human XM_024448369.1

PREDICTED: Homo sapiens pleckstrin homology domain containing A7 (PLEKHA7), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLEKHA7 (144100)
Length:
6841
CDS:
1328..5107

Additional Resources:

NCBI RefSeq record:
XM_024448369.1
NBCI Gene record:
PLEKHA7 (144100)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448369.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429919 GATCGCATAAGCCGCAAATAT pLKO_005 1676 CDS 100% 15.000 21.000 N PLEKHA7 n/a
2 TRCN0000438082 ACCCGGACATACGAGAGATTG pLKO_005 1960 CDS 100% 10.800 15.120 N PLEKHA7 n/a
3 TRCN0000130827 GACCTTCTCAAGGATCGAAGT pLKO.1 3230 CDS 100% 4.050 3.240 N PLEKHA7 n/a
4 TRCN0000146289 CCTGAGTGCAAATAAAGAGAA pLKO.1 3673 CDS 100% 4.950 3.465 N PLEKHA7 n/a
5 TRCN0000148775 CGAATACCTGAAGTTGGAGAA pLKO.1 3538 CDS 100% 4.050 2.835 N PLEKHA7 n/a
6 TRCN0000130794 GCCTTCACTCTCAACTTCTGA pLKO.1 3766 CDS 100% 3.000 2.100 N PLEKHA7 n/a
7 TRCN0000148812 CTGAGCATCTTCTGTGAACAA pLKO.1 3293 CDS 100% 4.950 2.970 N PLEKHA7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448369.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14391 pDONR223 100% 59.1% 59.1% None (many diffs) n/a
2 ccsbBroad304_14391 pLX_304 0% 59.1% 59.1% V5 (many diffs) n/a
3 TRCN0000480609 CACTGCCAGTATACCGGTAATTGT pLX_317 17.5% 59.1% 59.1% V5 (many diffs) n/a
Download CSV