Transcript: Human XM_024448491.1

PREDICTED: Homo sapiens glutamine amidotransferase like class 1 domain containing 1 (GATD1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GATD1 (347862)
Length:
2002
CDS:
26..607

Additional Resources:

NCBI RefSeq record:
XM_024448491.1
NBCI Gene record:
GATD1 (347862)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448491.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122471 GCCCTCTACTTCCTCACAGTT pLKO.1 1722 3UTR 100% 4.950 3.465 N GATD1 n/a
2 TRCN0000141816 GTGGATGTGACTGAGAGCAAT pLKO.1 185 CDS 100% 4.950 3.465 N GATD1 n/a
3 TRCN0000143864 CCATGGAATTTGTGGATGTGA pLKO.1 174 CDS 100% 3.000 2.100 N GATD1 n/a
4 TRCN0000141415 CTTCCTCCACTGTTTCACGAT pLKO.1 106 CDS 100% 2.640 1.848 N GATD1 n/a
5 TRCN0000144970 GACCATGAGATTCTCAATGAT pLKO.1 1544 3UTR 100% 5.625 3.375 N GATD1 n/a
6 TRCN0000142618 GATGTGACTGAGAGCAATGCA pLKO.1 188 CDS 100% 3.000 1.800 N GATD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448491.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13615 pDONR223 100% 66.6% 61.2% None (many diffs) n/a
2 ccsbBroad304_13615 pLX_304 0% 66.6% 61.2% V5 (many diffs) n/a
3 TRCN0000479507 CAGGCAAGCGCAATGCGGGTATTA pLX_317 26.5% 66.6% 61.2% V5 (many diffs) n/a
Download CSV