Construct: ORF TRCN0000479507
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016770.1_s317c1
- Derived from:
- ccsbBroadEn_13615
- DNA Barcode:
- CAGGCAAGCGCAATGCGGGTATTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GATD1 (347862)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479507
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 347862 | GATD1 | glutamine amidotransferase ... | XM_024448490.1 | 80.3% | 75.8% | (many diffs) |
2 | human | 347862 | GATD1 | glutamine amidotransferase ... | NM_182612.4 | 77.2% | 73% | (many diffs) |
3 | human | 347862 | GATD1 | glutamine amidotransferase ... | NM_001318821.2 | 77% | 73% | (many diffs) |
4 | human | 347862 | GATD1 | glutamine amidotransferase ... | XM_017017662.1 | 74.4% | 66% | (many diffs) |
5 | human | 347862 | GATD1 | glutamine amidotransferase ... | XM_011520064.2 | 73.6% | 72.2% | (many diffs) |
6 | human | 347862 | GATD1 | glutamine amidotransferase ... | XM_024448491.1 | 66.6% | 61.2% | (many diffs) |
7 | human | 347862 | GATD1 | glutamine amidotransferase ... | XM_005252898.2 | 65.3% | 62.2% | 450_490del;558_559ins233 |
8 | human | 347862 | GATD1 | glutamine amidotransferase ... | XM_017017664.1 | 65.3% | 62.2% | 450_490del;558_559ins233 |
9 | human | 347862 | GATD1 | glutamine amidotransferase ... | NM_001318824.2 | 63.5% | 58.9% | (many diffs) |
10 | human | 347862 | GATD1 | glutamine amidotransferase ... | NM_001318820.2 | 63.2% | 58.9% | (many diffs) |
11 | human | 347862 | GATD1 | glutamine amidotransferase ... | XM_024448492.1 | 61.3% | 56.1% | (many diffs) |
12 | human | 347862 | GATD1 | glutamine amidotransferase ... | NM_001318818.2 | 58.1% | 53.9% | (many diffs) |
13 | human | 347862 | GATD1 | glutamine amidotransferase ... | NM_001318823.2 | 57.9% | 53.9% | (many diffs) |
14 | human | 347862 | GATD1 | glutamine amidotransferase ... | XM_017017668.1 | 53.8% | 52.3% | (many diffs) |
15 | human | 347862 | GATD1 | glutamine amidotransferase ... | XM_017017667.1 | 51.7% | 47.8% | 247_248ins108;342_382del;450_451ins233 |
16 | human | 347862 | GATD1 | glutamine amidotransferase ... | NM_001318822.2 | 44.2% | 39.9% | (many diffs) |
17 | human | 347862 | GATD1 | glutamine amidotransferase ... | NR_134868.2 | 15.5% | (many diffs) | |
18 | human | 347862 | GATD1 | glutamine amidotransferase ... | NR_134867.2 | 13.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 819
- ORF length:
- 750
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcgtccgag cggctcccta acaggcccgc ctgtctgctc gtggccagcg 121 gcgccgccga aggtgtgtcg gcccagtcct tcctccactg tttcacgatg gccagcaccg 181 ccttcaacct gcaggtggcc acccctgggg ggaaagccat ggaatttgtg gatgtgactg 241 agagcaatgc acgctgggtg caagacttcc gcctcaaggc ttacgccagc cccgccaagc 301 tcgagtccat cgatggtgcc cggtaccatg ccctcctgat ccccagctgt cctggggccc 361 tgaccgacct ggccagcagt ggctccctgg cccgtatcct gcagcacttc cactctgaga 421 gcaaacccat ctgcgccgtc ggccacggtg tcgccgccct gtgctgtgcc accaacgagg 481 acagatcctg ggtgttcgac agctacagcc tgacagggcc ctctgtgtgt gagctcgtca 541 gggcccccgg cttcgcccgc ctgccgctcg tggtggagga cttcgtgaag gattcgggcg 601 cctgcttcag tggagcagca gcctCCTGCC CCAAGGCCGA CCGGCACTGG CAGCACTTTC 661 CTGTTGAAGA AATCTTCCTG GCGTGTGGTT TCAAAGTGGC AGGGCTTGGG GCAGCACCAG 721 GCTGGGGCAG AGGAGGAAAG CAAGAGGACA GACCTCCAGA AGAGCAGCGG AGGGCGGGTG 781 AGGATTTCCC CATATACCAG TGTGTGTTCA TCTACCCATT GCCAACTTTC TTGTACAAAG 841 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 901 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 961 ACGACAGGCA AGCGCAATGC GGGTATTAAC GCGTTAAGTC gacaatcaac ctctggatta 1021 caaaatttgt gaaagatt