Transcript: Human XM_024448618.1

PREDICTED: Homo sapiens patatin like phospholipase domain containing 2 (PNPLA2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PNPLA2 (57104)
Length:
2317
CDS:
215..1957

Additional Resources:

NCBI RefSeq record:
XM_024448618.1
NBCI Gene record:
PNPLA2 (57104)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448618.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222744 CCTGCCACTCTATGAGCTTAA pLKO.1 730 CDS 100% 10.800 7.560 N PNPLA2 n/a
2 TRCN0000078194 CCAAGTTCATTGAGGTATCTA pLKO.1 414 CDS 100% 5.625 3.938 N PNPLA2 n/a
3 TRCN0000078196 GCCACTCTATGAGCTTAAGAA pLKO.1 733 CDS 100% 5.625 3.938 N PNPLA2 n/a
4 TRCN0000078197 GAATGTCATTATATCCCACTT pLKO.1 589 CDS 100% 4.050 2.835 N PNPLA2 n/a
5 TRCN0000078193 CCCTTTACTCCTGAGAACTTT pLKO.1 2192 3UTR 100% 5.625 3.375 N PNPLA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448618.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08697 pDONR223 100% 86.8% 75.7% None 873C>G;919_1060del;1315_1400del n/a
2 ccsbBroad304_08697 pLX_304 0% 86.8% 75.7% V5 873C>G;919_1060del;1315_1400del n/a
3 TRCN0000468882 TCTGTAAGCTCTGTTATACATTCA pLX_317 29.5% 86.8% 75.7% V5 873C>G;919_1060del;1315_1400del n/a
Download CSV