Transcript: Human XM_024448661.1

PREDICTED: Homo sapiens mitochondrial ribosomal protein L11 (MRPL11), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MRPL11 (65003)
Length:
1325
CDS:
70..615

Additional Resources:

NCBI RefSeq record:
XM_024448661.1
NBCI Gene record:
MRPL11 (65003)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448661.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117463 GCCTGACAGGACATTTGAAAT pLKO.1 288 CDS 100% 13.200 10.560 N MRPL11 n/a
2 TRCN0000299899 GCCTGACAGGACATTTGAAAT pLKO_005 288 CDS 100% 13.200 10.560 N MRPL11 n/a
3 TRCN0000117464 AGGAGTTCAATGAGAGGACAA pLKO.1 221 CDS 100% 4.050 2.835 N MRPL11 n/a
4 TRCN0000299958 AGGAGTTCAATGAGAGGACAA pLKO_005 221 CDS 100% 4.050 2.835 N MRPL11 n/a
5 TRCN0000117466 GCCCGCATCAAAGCTCAGGAT pLKO.1 430 CDS 100% 0.880 0.616 N MRPL11 n/a
6 TRCN0000331208 GCCCGCATCAAAGCTCAGGAT pLKO_005 430 CDS 100% 0.880 0.616 N MRPL11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448661.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08885 pDONR223 100% 89.3% 81.4% None (many diffs) n/a
2 ccsbBroad304_08885 pLX_304 0% 89.3% 81.4% V5 (many diffs) n/a
3 TRCN0000478717 ACTGAGACACCTTGAGGCGTACAT pLX_317 54.1% 89.3% 81.4% V5 (many diffs) n/a
Download CSV