Transcript: Human XM_024448692.1

PREDICTED: Homo sapiens coiled-coil domain containing 82 (CCDC82), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC82 (79780)
Length:
5225
CDS:
2710..4344

Additional Resources:

NCBI RefSeq record:
XM_024448692.1
NBCI Gene record:
CCDC82 (79780)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448692.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430766 ACGCAGTAGTGGTAGAGATTT pLKO_005 3471 CDS 100% 13.200 18.480 N CCDC82 n/a
2 TRCN0000435881 GTTGATTGGAGGCGAACTAAA pLKO_005 2779 CDS 100% 13.200 18.480 N CCDC82 n/a
3 TRCN0000129823 CAAGTGAATGAGCTGTTGATA pLKO.1 4616 3UTR 100% 5.625 3.938 N CCDC82 n/a
4 TRCN0000127543 CCAGGACCATGCAAATAGATA pLKO.1 4046 CDS 100% 5.625 3.938 N CCDC82 n/a
5 TRCN0000129904 GCCGTACCAGAATTTATCATA pLKO.1 4118 CDS 100% 5.625 3.938 N CCDC82 n/a
6 TRCN0000128463 GAAGAGCTTGATAGTGAAGAA pLKO.1 2833 CDS 100% 4.950 3.465 N CCDC82 n/a
7 TRCN0000128006 GAGTCTTTCAACCCTCACATT pLKO.1 4934 3UTR 100% 4.950 3.465 N CCDC82 n/a
8 TRCN0000129929 GATGAAGAGCTTGATAGTGAT pLKO.1 2863 CDS 100% 4.950 3.465 N CCDC82 n/a
9 TRCN0000130855 GCTGTTGATATCCTGTCAGTT pLKO.1 4627 3UTR 100% 4.950 3.465 N CCDC82 n/a
10 TRCN0000412553 GTGAAAGAGAGCTCAACTTAA pLKO_005 2951 CDS 100% 13.200 7.920 N CCDC82 n/a
11 TRCN0000130856 GATAGTAACAAGGGACCTGAT pLKO.1 2911 CDS 100% 4.050 2.430 N CCDC82 n/a
12 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 1057 5UTR 100% 4.050 2.025 Y P3H4 n/a
13 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 1057 5UTR 100% 4.050 2.025 Y ORAI2 n/a
14 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 1057 5UTR 100% 4.050 2.025 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448692.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12616 pDONR223 100% 62.5% 60.8% None (many diffs) n/a
2 ccsbBroad304_12616 pLX_304 0% 62.5% 60.8% V5 (many diffs) n/a
3 TRCN0000472780 CCTAACGTGGAAGGAAAGCCTGCG pLX_317 52.3% 62.5% 60.8% V5 (many diffs) n/a
Download CSV