Transcript: Human XM_024448816.1

PREDICTED: Homo sapiens polypeptide N-acetylgalactosaminyltransferase 6 (GALNT6), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GALNT6 (11226)
Length:
4926
CDS:
549..2417

Additional Resources:

NCBI RefSeq record:
XM_024448816.1
NBCI Gene record:
GALNT6 (11226)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448816.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093967 GCACATCGGTACCTATGATAA pLKO.1 1649 CDS 100% 0.000 0.000 N Galnt6 n/a
2 TRCN0000035491 GCAGACTCTGTTCTCCATAAA pLKO.1 785 CDS 100% 13.200 9.240 N GALNT6 n/a
3 TRCN0000438019 AGCACAGAGGAGCACCTAAAG pLKO_005 1203 CDS 100% 10.800 7.560 N GALNT6 n/a
4 TRCN0000439851 AGCTTCTCTGGAGGCCGTAAA pLKO_005 2496 3UTR 100% 10.800 7.560 N GALNT6 n/a
5 TRCN0000035492 CGGCAACCAGTACTTTGAGTA pLKO.1 2141 CDS 100% 4.950 3.465 N GALNT6 n/a
6 TRCN0000035490 GCACAATGTCTACCCAGAGAT pLKO.1 1991 CDS 100% 4.950 3.465 N GALNT6 n/a
7 TRCN0000035489 GCCATGAACAACCTTAGAGAT pLKO.1 726 CDS 100% 4.950 3.465 N GALNT6 n/a
8 TRCN0000035493 CGGTACCTATGATAATCAGAT pLKO.1 1655 CDS 100% 0.000 0.000 N GALNT6 n/a
9 TRCN0000256745 CAGCCTGGCCAACATGGTAAA pLKO_005 3910 3UTR 100% 10.800 5.400 Y SMIM11A n/a
10 TRCN0000093968 CCTGACCTTCGGCTGGGAAAT pLKO.1 1526 CDS 100% 3.600 2.520 N Galnt6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448816.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07776 pDONR223 100% 99.9% 100% None 1852T>C n/a
2 ccsbBroad304_07776 pLX_304 0% 99.9% 100% V5 1852T>C n/a
3 TRCN0000469872 TCTAGGTTCCCGGTCCCTTTTTAC pLX_317 20.6% 99.9% 100% V5 1852T>C n/a
4 ccsbBroadEn_07777 pDONR223 100% 99.9% 99.8% None 1397T>C n/a
5 ccsbBroad304_07777 pLX_304 0% 99.9% 99.8% V5 1397T>C n/a
6 TRCN0000466957 AGTAAACTATATCATTCACATCGA pLX_317 20.5% 99.9% 99.8% V5 1397T>C n/a
Download CSV