Transcript: Human XM_024448870.1

PREDICTED: Homo sapiens PTC7 protein phosphatase homolog (PPTC7), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPTC7 (160760)
Length:
831
CDS:
5..757

Additional Resources:

NCBI RefSeq record:
XM_024448870.1
NBCI Gene record:
PPTC7 (160760)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448870.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000315056 TTGACAACATGCCTGATTATA pLKO_005 681 CDS 100% 15.000 21.000 N PPTC7 n/a
2 TRCN0000315055 GGACGGTTCGTACCTAGTAAT pLKO_005 326 CDS 100% 13.200 18.480 N PPTC7 n/a
3 TRCN0000381127 GCTGCTGATAGCACGTCTTTC pLKO_005 614 CDS 100% 10.800 8.640 N PPTC7 n/a
4 TRCN0000002704 CTCAATTCTCAGGGACTTTAA pLKO.1 276 CDS 100% 13.200 9.240 N PPTC7 n/a
5 TRCN0000315120 CTCAATTCTCAGGGACTTTAA pLKO_005 276 CDS 100% 13.200 9.240 N PPTC7 n/a
6 TRCN0000379897 GTCCAGCTAGGAGACATTATC pLKO_005 638 CDS 100% 13.200 9.240 N PPTC7 n/a
7 TRCN0000002702 GCATTACTTCAACACTCCATT pLKO.1 535 CDS 100% 4.950 3.465 N PPTC7 n/a
8 TRCN0000002703 GAGACATTATCCTGACGGCAA pLKO.1 648 CDS 100% 2.160 1.512 N PPTC7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448870.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05108 pDONR223 100% 81.8% 80.5% None (many diffs) n/a
2 ccsbBroad304_05108 pLX_304 0% 81.8% 80.5% V5 (many diffs) n/a
3 TRCN0000475008 CGCAAACGCTTCGTTCCAGATGTG pLX_317 51.7% 81.8% 80.5% V5 (many diffs) n/a
Download CSV