Transcript: Human XM_024448878.1

PREDICTED: Homo sapiens epidermal growth factor receptor pathway substrate 8 (EPS8), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EPS8 (2059)
Length:
3933
CDS:
360..2861

Additional Resources:

NCBI RefSeq record:
XM_024448878.1
NBCI Gene record:
EPS8 (2059)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448878.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061544 CCAACTTCTAATCGCCATATA pLKO.1 1935 CDS 100% 13.200 9.240 N EPS8 n/a
2 TRCN0000299641 CCAACTTCTAATCGCCATATA pLKO_005 1935 CDS 100% 13.200 9.240 N EPS8 n/a
3 TRCN0000061545 GCCAAACTGAAGTCTCATATT pLKO.1 1419 CDS 100% 13.200 9.240 N EPS8 n/a
4 TRCN0000299643 GCCAAACTGAAGTCTCATATT pLKO_005 1419 CDS 100% 13.200 9.240 N EPS8 n/a
5 TRCN0000061543 CCCTATTGAATAAGGACACAA pLKO.1 1543 CDS 100% 4.950 3.465 N EPS8 n/a
6 TRCN0000299644 CCCTATTGAATAAGGACACAA pLKO_005 1543 CDS 100% 4.950 3.465 N EPS8 n/a
7 TRCN0000061546 CCAGCAAATATAACACGTCAA pLKO.1 2343 CDS 100% 4.050 2.835 N EPS8 n/a
8 TRCN0000061547 GCTAGTGATTCAGGAGTGGAA pLKO.1 2814 CDS 100% 2.640 1.848 N EPS8 n/a
9 TRCN0000299640 GCTAGTGATTCAGGAGTGGAA pLKO_005 2814 CDS 100% 2.640 1.848 N EPS8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448878.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06172 pDONR223 100% 98.6% 98.5% None 1_33del;1925C>T n/a
2 ccsbBroad304_06172 pLX_304 0% 98.6% 98.5% V5 1_33del;1925C>T n/a
3 TRCN0000480737 CCTAAATCACCCTATCTGTTGCGG pLX_317 17% 98.6% 98.5% V5 1_33del;1925C>T n/a
Download CSV