Transcript: Human XM_024448922.1

PREDICTED: Homo sapiens methionine sulfoxide reductase B3 (MSRB3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MSRB3 (253827)
Length:
465
CDS:
45..464

Additional Resources:

NCBI RefSeq record:
XM_024448922.1
NBCI Gene record:
MSRB3 (253827)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448922.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294008 TCCGGGTCGTGTAGGGATAAA pLKO_005 270 CDS 100% 13.200 17.160 N MSRB3 n/a
2 TRCN0000429388 CACAAAGATCCTGGAATATAT pLKO_005 408 CDS 100% 15.000 10.500 N Msrb3 n/a
3 TRCN0000298671 TCAGGAGAAAGGGACCGAAAG pLKO_005 362 CDS 100% 6.000 4.200 N MSRB3 n/a
4 TRCN0000064762 AGGAGAATACACACATCACAA pLKO.1 392 CDS 100% 4.950 3.465 N MSRB3 n/a
5 TRCN0000064759 GTGTTGTTTGTGGAACTCCAT pLKO.1 433 CDS 100% 2.640 1.848 N MSRB3 n/a
6 TRCN0000085621 GTACCATGTCACTCAGGAGAA pLKO.1 350 CDS 100% 0.000 0.000 N Msrb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448922.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05292 pDONR223 100% 31.3% 29.2% None (many diffs) n/a
2 ccsbBroad304_05292 pLX_304 0% 31.3% 29.2% V5 (many diffs) n/a
3 TRCN0000472383 AGTTTACATGTATCCGCCAGTTAC pLX_317 85.9% 31.3% 29.2% V5 (many diffs) n/a
Download CSV