Transcript: Human XM_024448970.1

PREDICTED: Homo sapiens integrin subunit alpha 5 (ITGA5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITGA5 (3678)
Length:
2788
CDS:
119..1756

Additional Resources:

NCBI RefSeq record:
XM_024448970.1
NBCI Gene record:
ITGA5 (3678)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029652 CCTCAGGAACGAGTCAGAATT pLKO.1 376 CDS 100% 0.000 0.000 N ITGA5 n/a
2 TRCN0000230126 AGGCAGATCCAGGACTATATT pLKO_005 2438 3UTR 100% 15.000 10.500 N ITGA5 n/a
3 TRCN0000230125 CTCAGGCCAGCCCTACATTAT pLKO_005 473 CDS 100% 13.200 9.240 N ITGA5 n/a
4 TRCN0000029653 CTCCTATATGTGACCAGAGTT pLKO.1 1178 CDS 100% 4.950 3.465 N ITGA5 n/a
5 TRCN0000029651 CCACTGTGGATCATCATCCTA pLKO.1 1598 CDS 100% 3.000 2.100 N ITGA5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00884 pDONR223 100% 51.9% 51.9% None 0_1ins1512 n/a
2 ccsbBroad304_00884 pLX_304 0% 51.9% 51.9% V5 0_1ins1512 n/a
3 TRCN0000479120 TTAAGGAATAGATCAATCATAGTC pLX_317 13.4% 51.9% 51.9% V5 0_1ins1512 n/a
Download CSV