Transcript: Human XM_024449097.1

PREDICTED: Homo sapiens SLIT-ROBO Rho GTPase activating protein 1 (SRGAP1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRGAP1 (57522)
Length:
5375
CDS:
907..2382

Additional Resources:

NCBI RefSeq record:
XM_024449097.1
NBCI Gene record:
SRGAP1 (57522)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449097.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251714 CCAGTGAACTGCTGGTATTTG pLKO_005 1192 CDS 100% 13.200 10.560 N Srgap1 n/a
2 TRCN0000047554 GCTGAAATTGAGACGGAATAT pLKO.1 1075 CDS 100% 13.200 9.240 N SRGAP1 n/a
3 TRCN0000289515 GCTGAAATTGAGACGGAATAT pLKO_005 1075 CDS 100% 13.200 9.240 N SRGAP1 n/a
4 TRCN0000047555 GCAGAGATTCATGGAGATGTA pLKO.1 1851 CDS 100% 4.950 2.970 N SRGAP1 n/a
5 TRCN0000289516 GCAGAGATTCATGGAGATGTA pLKO_005 1851 CDS 100% 4.950 2.970 N SRGAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449097.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12358 pDONR223 100% 83.8% 83.2% None (many diffs) n/a
2 ccsbBroad304_12358 pLX_304 0% 83.8% 83.2% V5 (many diffs) n/a
3 TRCN0000481319 ACTAATCCGTAGCTAAGATCATCA pLX_317 34.2% 83.8% 83.2% V5 (many diffs) n/a
Download CSV