Transcript: Human XM_024449410.1

PREDICTED: Homo sapiens ORC ubiquitin ligase 1 (OBI1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OBI1 (79596)
Length:
3319
CDS:
76..2025

Additional Resources:

NCBI RefSeq record:
XM_024449410.1
NBCI Gene record:
OBI1 (79596)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449410.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285989 AGCAGTTCACATCGACTATTT pLKO_005 1813 CDS 100% 13.200 18.480 N OBI1 n/a
2 TRCN0000277660 ATGTATCTCGGTTGGATATAC pLKO_005 2333 3UTR 100% 13.200 18.480 N OBI1 n/a
3 TRCN0000137082 CCTGGAACGAAGTGATAAGTA pLKO.1 561 CDS 100% 5.625 7.875 N OBI1 n/a
4 TRCN0000277659 TCCAAAGGTTCTCTAACTAAT pLKO_005 1618 CDS 100% 13.200 10.560 N OBI1 n/a
5 TRCN0000136897 CACTGGATTTGGATGGGTTAT pLKO.1 1526 CDS 100% 10.800 8.640 N OBI1 n/a
6 TRCN0000285990 CACTGGATTTGGATGGGTTAT pLKO_005 1526 CDS 100% 10.800 8.640 N OBI1 n/a
7 TRCN0000134397 GTGAGAAATCAGGCTTATGTT pLKO.1 1343 CDS 100% 5.625 4.500 N OBI1 n/a
8 TRCN0000134953 GATAAGCTAAAGGAGGCAAAT pLKO.1 379 CDS 100% 10.800 7.560 N OBI1 n/a
9 TRCN0000137111 CCAGTTCTTGTCCAGTAACTA pLKO.1 1733 CDS 100% 5.625 3.938 N OBI1 n/a
10 TRCN0000277597 CCAGTTCTTGTCCAGTAACTA pLKO_005 1733 CDS 100% 5.625 3.938 N OBI1 n/a
11 TRCN0000133667 GCTTCATTGTTCCAGATGTAA pLKO.1 2856 3UTR 100% 5.625 3.938 N OBI1 n/a
12 TRCN0000125457 CAGTCCAAAGTAGAACAGTAT pLKO.1 511 CDS 100% 4.950 2.970 N Rnf219 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449410.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12571 pDONR223 100% 83.2% 82.8% None 1601_1602insT;1623_1947del n/a
2 ccsbBroad304_12571 pLX_304 0% 83.2% 82.8% V5 1601_1602insT;1623_1947del n/a
3 TRCN0000473310 CGGCGCGGGCATTGTATCTGGCCC pLX_317 23.6% 83.2% 82.8% V5 1601_1602insT;1623_1947del n/a
Download CSV