Transcript: Human XM_024449416.1

PREDICTED: Homo sapiens tudor domain containing 3 (TDRD3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TDRD3 (81550)
Length:
2449
CDS:
69..2216

Additional Resources:

NCBI RefSeq record:
XM_024449416.1
NBCI Gene record:
TDRD3 (81550)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356049 AGACGAATAGGACCTATTAAG pLKO_005 1581 CDS 100% 13.200 18.480 N TDRD3 n/a
2 TRCN0000073297 CGTACTTCTTACAAGCAATAA pLKO.1 752 CDS 100% 13.200 18.480 N TDRD3 n/a
3 TRCN0000367423 ACGAAGATCTGGGCCAATTAA pLKO_005 1664 CDS 100% 15.000 12.000 N TDRD3 n/a
4 TRCN0000367466 AGTAGCTGTGGTGGATATTAT pLKO_005 2268 3UTR 100% 15.000 10.500 N TDRD3 n/a
5 TRCN0000073294 GCAGTGGATTACCTAGAAATA pLKO.1 1114 CDS 100% 13.200 9.240 N TDRD3 n/a
6 TRCN0000222581 CGGGTATGACAGCAGTTGTTA pLKO.1 1816 CDS 100% 5.625 3.938 N TDRD3 n/a
7 TRCN0000073293 CCTTCCACTTTCTCTTCAGAA pLKO.1 2245 3UTR 100% 4.950 3.465 N TDRD3 n/a
8 TRCN0000073295 GCAGAGAACTTGATCGAAGAA pLKO.1 385 CDS 100% 4.950 3.465 N TDRD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04235 pDONR223 100% 91% 85.9% None 1837_1988del;2106_2145del n/a
2 ccsbBroad304_04235 pLX_304 0% 91% 85.9% V5 1837_1988del;2106_2145del n/a
3 TRCN0000479596 AACCGTCCCGTTAGTCGCAACCCA pLX_317 16.6% 91% 85.9% V5 1837_1988del;2106_2145del n/a
Download CSV